a variant of guillain barré syndrome
Báo cáo y học: "Facial diplegia with hyperreflexia-a mild Guillain-Barre Syndrome variant, to treat or not to treat" potx
... Hirata K, Yuki N: Acute facial diplegia and hyperreflexia A Guillain Barre syndrome variant Neurology 2004, 62:825-7 Kuwabara S, Ogawara K, Koga M, Mori M, Hattori T, Yuki N: Hyperreflexia in Guillain ... with isolated facial diplegia The fact that she was able to catwalk down a runaway in high heels clearly argued against any lower limb weakness at presentation It is unclear however if GBS patients ... cranial variant of Guillain Barre syndrome J R Soc Med 1999, 92:26-27 Ropper AH: Unusual clinical variants and signs in Guillain Barre syndrome Arch Neurol 1986, 43:1150-2 Susuki K, Atsumi M, Koga...
- 3
- 328
- 0
Báo cáo y học: "Development of recurrent facial palsy during plasmapheresis in Guillain-Barré syndrome: a case report" pdf
... Page of sided facial weakness with dysgeusia, and an obvious facial droop appeared The remainder of his neurological examination, including contralateral facial strength, remained unchanged A ... round of plasmapheresis, though the remainder of his facial paralysis persisted Because of the association of recurrent acute facial weakness during plasmapheresis, the therapy was discontinued and ... D: Plasma exchange for Guillain- Barré syndrome Cochrane Database Syst Rev 2001, 2:CD001798 Hahn AF: Guillain- Barré syndrome Lancet 1998, 352:635-641 Haupt WF, Rosenow F, van der Ven C, Birkmann...
- 4
- 348
- 0
Báo cáo y học: " Development of recurrent facial palsy during plasmapheresis in Guillain-Barré syndrome: a case report" pot
... Page of sided facial weakness with dysgeusia, and an obvious facial droop appeared The remainder of his neurological examination, including contralateral facial strength, remained unchanged A ... round of plasmapheresis, though the remainder of his facial paralysis persisted Because of the association of recurrent acute facial weakness during plasmapheresis, the therapy was discontinued and ... D: Plasma exchange for Guillain- Barré syndrome Cochrane Database Syst Rev 2001, 2:CD001798 Hahn AF: Guillain- Barré syndrome Lancet 1998, 352:635-641 Haupt WF, Rosenow F, van der Ven C, Birkmann...
- 4
- 329
- 0
báo cáo khoa học: " Guillain-Barré syndrome after tetanus toxoid, reduced diphtheria toxoid and acellular pertussis vaccine: a case report" pps
... days Tingling and numbness, profound weakness of the Symptomatic extremities, bilateral peripheral facial paresis, bulbar treatment and weakness, bilateral weakness of ocular abduction physical ... Ammar Journal of Medical Case Reports 2011, 5:502 http://www.jmedicalcasereports.com/content/5/1/502 Page of Table Cases describing the association of tetanus vaccination and GBS Case Tetanus ... administration of a Tdap vaccine Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available...
- 3
- 235
- 0
Báo cáo y học: "A possible variant of Bouveret’s syndrome presenting as a duodenal stump obstruction by a gallstone after Roux-en-Y gastrectomy: a case report" pot
... gastrointestinal injury due to the presence of adhesions Bouveret’s syndrome is a rare complication of gallstone disease [1], and is characterized by passage of a large stone through a cholecystoduodenal ... gallbladder into the duodenum via the papilla and became enlarged by a process of accretion as a result of the stricture in D2, ultimately leading to obstruction of the duodenal stump Page of ... the study All authors have read and approved the final manuscript References Cappell MS, Davis M: Characterization of Bouveret’s syndrome: a comprehensive review of 128 cases Am J Gastroenterol...
- 3
- 271
- 0
Báo cáo y học: " Guillain-Barré Syndrome with asystole requiring permanent pacemaker: a case report" pot
... the sympathetic or parasympathetic pathways We report a case of GuillainBarré syndrome requiring permanent pacemaker for severe bradycardia Case Presentation An 18-year-old Caucasian female presented ... supraventricular tachycardia, junctional tachycardia and ventricular tachycardia have also been reported The risk of dysautonomia is higher in patients with quadriplegia, respiratory failure or bulbar involvement ... the same patient Parasympathetic overactivity may be intermittent, may cause serious bradyarrhythmias ranging from bradycardia to asystole, and may account for a significant number of deaths...
- 4
- 469
- 0
Báo cáo y học: " A review of bronchiolitis obliterans syndrome and therapeutic strategies." doc
... 26 Hachem RR, Khalifah AP, Chakinala MM, Yusen RD, Aloush AA, Mohanakumar T, Patterson GA, Trulock EP, Walter MJ: The significance of a single episode of minimal acute rejection after lung transplantation ... disease affecting pulmonary function In comparison, acute allograft rejection is defined as perivascular or peribronchial mononuclear inflammation that may be associated with Page of an acute ... airtrapping, further supporting the diagnosis of BOS in that allograft Aggressive treatment of GE reflux, avoidance of infection, and timely vaccinations are instrumental in managing lung transplant...
- 9
- 436
- 0
Báo cáo y học: "Leukocyte oxygen radical production determines disease severity in the recurrent Guillain-Barré syndrome" doc
... were added The change in absorbance was measured at 510 nm for (Perkin Elmer lambda 2) in duplicate and the mean value was used for statistical analysis Microbiological analyses A standardized ... first attack and followup was 15 years (0.5-40 years) A total of 38 attacks occurred in these patients (median per patient, range 2-7) (Table 1) Five patients had complete recovery and patients had ... by IF assay of IgG and IgM antibodies against EBV, mumps, measles, and Toxoplasma gondii; by ELISA of IgM for enteroviruses, rubella, RSV and Mycoplasma pneumoniae; and by complement fixation...
- 6
- 221
- 0
Báo cáo y học: " Leukocyte oxygen radical production determines disease severity in the recurrent Guillain-Barré syndrome" ppt
... were added The change in absorbance was measured at 510 nm for (Perkin Elmer lambda 2) in duplicate and the mean value was used for statistical analysis Microbiological analyses A standardized ... first attack and followup was 15 years (0.5-40 years) A total of 38 attacks occurred in these patients (median per patient, range 2-7) (Table 1) Five patients had complete recovery and patients had ... by IF assay of IgG and IgM antibodies against EBV, mumps, measles, and Toxoplasma gondii; by ELISA of IgM for enteroviruses, rubella, RSV and Mycoplasma pneumoniae; and by complement fixation...
- 6
- 341
- 0
Báo cáo y học: " Functional markers to predict the need for prolonged mechanical ventilation in patients with Guillain-Barré syndrome" ppsx
... 96:178-180 Sharshar T, Chevret S, Bourdain F, Raphaël JC; French Cooperative Group on Plasma Exchange in Guillain- Barré Syndrome: Early predictors of mechanical ventilation in Guillain- Barré syndrome ... mechanical ventilation in patients with Guillain- Barré syndrome Crit Care 2011, 15:R65 Plummer AL, Gracey DR: Consensus conference on artificial airways in patients receiving mechanical ventilation ... Zhang et al Critical Care 2011, 15:426 http://ccforum.com/content/15/3/426 Abbreviations GBS, Guillain- Barré syndrome; MV, mechanical ventilation; NIMV, non-invasive mechanical ventilation...
- 2
- 294
- 0
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx
... methylated DNA were: 5¢-AAGTAGGCGGAGTATCGAAC-3¢ (sense) and 5¢-GAAAAAACGCGATCCTACTT-3¢ (antisense) Primers for unmethylated DNA were: 5¢-GAAGTAGGTGGAGT ATTGAAT-3¢ (sense) and 5¢-CAAAAAAACACAATCCT ACTT-3¢ ... used were: 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCATAGCCATAGCCACTTC C-3¢ (antisense) for ... transcriptase (Promega, Madison, WI, USA) For PCR of occludin variants, the primers used were: 5¢-ACTCGACAATGAACAATCCGTCAGAA-3¢ (sense) and 5¢-AGAGTATGCCATGGGACTGTCA-3¢ (antisense) for exon 5; 5¢-TGCAGG-TGCTCTTTTTGAAGGT-3¢...
- 12
- 613
- 0
Tài liệu Báo cáo khoa học: A unique variant of streptococcal group O-antigen (C-polysaccharide) that lacks phosphocholine ppt
... smaller amount of a tetrasaccharide-ribitol The data shows that the AAT residue is indeed an acetamido-amino derivative and supports the postulated repeat as CBADE From the combined data obtained ... ethanolamine moieties as the signal at dP 0.33 correlates to dH 4.09 (H- 1a and H-1b, of F) and to dH 4.02 (H- 6a and H-6b, of A) and as the signal at dP – 0.04 correlated to dH 4.13 (H- 1a and H-1b, of ... signals of equal intensity at d 1.33, 0.33, and )0.04 (Fig 2) All three signals could be assigned to a polysaccharide similar to C-polysaccharide The signal at d 1.33 was assigned to a phosphate...
- 6
- 545
- 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... cacctcagGGTCACGCC 1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 64 AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG 1028 utilized for ... inflammation A Ray et al Fig Analysis of a structurally altered form of SAF The nucleic acid and predicted amino acid sequences of the cDNA encoding SAF-3 are shown The initiator ATG codon and ... 5¢-CCGCCATGGATCCCAGCAACTGGAGCAGC-3¢ (forward) and 5¢-GAGAACCGGGAGCAAGTCCAC-3¢ (reverse) The amplification product of the second PCR was 208 bp The reaction products were resolved in a 1.5% agarose...
- 11
- 439
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and ... Molecular characterization of ANKHD1 splice variant A B Fig Expression of VBARP isoforms in vitro and in vivo: (A) In vitro transcription ⁄ translation of VBARP-L and VBARP-S One microgram of VBARP-L,...
- 12
- 561
- 0
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot
... AACGAGgtaggc ATCAAGgtaaga ACACAGgtttga GCAAAGgtaatg GAGAAAgtaagt CTTCAGgtaatt ACCACGgtaggc TTGCAAgtatgc ACCAGGgtaagt AACAAGgtaaga TACCAGgtatga TTGATGgtgaga CAGAAGgtaaca GGAAGGgtgagt 35209 16864 ... 70034 ttacagGTTTCT ctgcagGCTGTG ttttagATTCAA ttgcagGTCTGT ttatagGTTGCT tttcagGATGTG aaccagGTTATT tttcagACCCTA atttagCTTCAT ctttagGGGAAA atctagCATTGA atgtagGCAAAA aatcagGATGTT tttcagCTTTGA gene ... 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5¢-GGAATTCATGCCGACCACAACCGTT TTAAG-3¢ and 5¢-GGAGACAGTGACAAGTTATCTA GTGCT-3¢ for XPR70 PCR products were resolved on a 1.5% (w/v) agarose...
- 12
- 507
- 0
Báo cáo khoa học: On the aggregation properties of FMRP – a link with the FXTAS syndrome? pot
... microscopy analysis and Steve Howell for mass spectrometry analysis We are grateful to Cesira de Chiara and Laura Masino for critical discussion and assistance in graphic elaboration of CD results We acknowledge ... fibrils with an average diameter of nm (Fig 6C) FX1RP Nt-NES aggregates have a curved appearance, with an apparent average diameter of 10 nm (Fig 6D) They also clustered together and were often found ... & Pastore A (2010) Functional interactions as a survival strategy against abnormal aggregation FASEB J 25, 45–54 32 Adrover M, Pauwels K, Prigent S, de Chiara C, Xu Z, Chapuis C, Pastore A &...
- 10
- 415
- 0
Báo cáo khoa học: Characterization of the dimerization process of a domain-swapped dimeric variant of human pancreatic ribonuclease pdf
... Chromatographic characterization of oligomers of the human pancreatic ribonuclease variants PM8 and PM8E103C The sizeexclusion profiles are shown of the human pancreatic ribonuclease variant, ... Journal compilation ª 2006 FEBS ´ M Rodrıguez et al Mechanism of dimerization of an HP-RNase variant Fig Measurement of the dissociation constant of the human pancreatic ribonuclease variant, ... have exchanged the N-terminal domain (Fig 7) A B Fig Scheme for the putative mechanism of domain-swapping dimerization of RNase A and the human pancreatic ribonuclease variant, PM8 For RNase A...
- 11
- 411
- 0
Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt
... (5¢-GTCGTCTTGCGGTCACCT GGACATGCATCAACGAACAG-3¢) and Ct-Aspf1 (5¢-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA GTCTCAAGTC-3¢) These primers contained BstEII and BamHI sites and were used to generate a fragment that ... ´-Ortega et al L Garcia Variants of the A fumigatus allergen Aspf1 Martı´ nez-Ruiz A, Garcı´ a- Ortega L, Kao R, Lacadena J, Onaderra M, Mancheno JM, Davies J, Martı´ nez del ˜ ˜ Pozo A & Gavilanes ... antigens Diagnosis Aspf1 D(7–22) vs Aspf 1a a-sarcin vs Aspf 1a a-sarcin D(7–22) vs Aspf 1a a-sarcin D(7–22) vs a- sarcina Asthma Cystic fibrosis ABPA 33 50 20 33 30 33 50 89 70 20 33 22 a Data calculated...
- 9
- 517
- 0
Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx
... Cloning and characterization of Na+ channel b1B (Eur J Biochem 270) 4763 reaction (RT-PCR) and RACE-PCR Marathon-ReadyTM human adrenal gland and fetal brain cDNA libraries were purchased from ... probe was labeled and purified as described above A kb human b-actin cDNA fragment was used as the control probe and labeled with Ready-To-GoTM DNA Labelling Bead (–dCTP) (Amersham Pharmacia Biotech.), ... used for acquisition and analysis of data Leakage and linear capacity currents were subtracted by using P/4 protocols Data were sampled once every ls and were filtered at 1/5 of the sampling frequency...
- 9
- 415
- 0
Báo cáo khoa học: Identification of a novel alternative splicing variant of RGS5 mRNA in human ocular tissues ppt
... for angiotensin II receptor (AT 1a) cDNA cloning: 5¢-CGCGGATGAAGAAAATGAAT-3¢ (forward); 5¢-CCCTTTGGAAACTGGACAGA-3¢ (reverse) Primers used for cannabinoid receptor-1 (CB-1) cDNA cloning: 5¢-GAGGACCAGGGGATGCGAAGG-3¢; ... Exon5 aaaaaa Fig Alternative splicing of human RGS5 mRNA (RGS5s) Translation start site (ATG) defined as +1 Blocks represent exons and lines represent introns Exon1 Exon RGS mRNA Exon aaaaaa RGS ... 70–79 years old and male Caucasian with over 10 years glaucoma history Five normotensive eyes were obtained from NDRI at 48 h postmortem All donors were at age 70–79 years old and male Caucasian Using...
- 9
- 312
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008