a the axially dispersed plug flow model
Báo cáo khoa học: "Effects of dopexamine on the intestinal microvascular blood flow and leucocyte activation in a sepsis model in rats" pptx
Ngày tải lên :
13/08/2014, 02:24
... was 3.8, and at a rat TNF-α mass of 168.3 pg/ml it was 6.5 Statistical analysis The data analysis was performed by means of a statistical software package (SigmaStat; Jandel Scientific, Erkrath, ... UK) The arterial pressure and heart rate Page of (page number not for citation purposes) In one half of the animals of each group, LDF was performed The other half of the animals underwent examination ... were approved by our institutional review board for the care of animals and were performed in accordance with German legislation on protection of animals Anaesthesia and monitoring The animals...
- 8
- 380
- 0
Studying the physics of design flow incorporating early information using a simulation model
Ngày tải lên :
11/09/2015, 10:18
... rows and columns sequentially in the same order and a mark is placed in the matrix if there is an information flow (or parameter dependency) from one activity to the other (see Table 2.1) A mark ... on Table 2.1 DSM in order to show the dependency Activity A1 A2 A3 A4 A5 A6 A7 A1 A2 x x x A3 A4 A5 A6 x A7 x x x x x x x x information that is yet to be produced by a succeeding activity The ... Predicting change propagation and proper quantification of the change impact on redesign and on the design duration is important to manage the design process Handling coupled activities and managing...
- 290
- 265
- 0
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf
Ngày tải lên :
20/02/2014, 04:20
... the mathematical model and performed experiments on language data of the morphologically complex language Zulu We compared the performance on increasing training set sizes and analysed for each ... 2006) They used a natural language tagger which was trained on the output of ParaMor and Morfessor The goal was to mimic each algorithm since ParaMor is rule-based and there is no access to Morfessor’s ... performs better at the end For the boundary prediction in Figure 4b the signal disappears after calibration Concluding, it appears that our test language Zulu has certain features which are modelled...
- 9
- 557
- 0
Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx
Ngày tải lên :
07/03/2014, 10:20
... CAGCAACGCAAGCTTG GTCGACCTGCAGCCCAAGCTTGCGTTGCTG ATGTGGAAAATCTCTAGCAGGCTGCAGGTC GAC CAGCAACGCAAGCTTGATGTGGAAAATCTCT AGCA CAGCAACGCAAGCTT CAGCAACGCAAGCT CAGCAACGCAAG AGAGATTTTCCACAT CTAGAGATTTTCCACAT ... GACGTCATAGACGATTACATTGCTAGGACA TGCTGTCTAGAGACTATCGC GCGATAGTCTCTAGACAGCATGTCCTAGCAA GCCAGAATTCGGCAGCGTC GGACATCTTTGCCCACGTTGACCCG ATCTTTGCCCACGTTGACCCG TTGCCCACGTTGACCCG GCGATAGTCTCTAGACAGCATGTCC ... CGGTCAACGTGGGCATACAACGTGGCACTGT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTAT GTCCTAGCAAAGCGTATGTGATCACTGG GACGCTGCCGAATTCTGGCTTGCTAGGACAT CTTTGCCCACGTTGACCCG CGGGTCAACGTGGGCAAAGATGTCCTAGCAA TGTAATCGTCTATGACGTC GACGTCATAGACGATTACATTGCTAGGACA...
- 14
- 433
- 0
Working pAper series no 1041/ A pril 2009: An economic cApitAl model integrAting credit And interest rAte risk in the bAnking book doc
Ngày tải lên :
29/03/2014, 13:20
... is based on the same conceptual framework as Basel II and the main commercially available credit risk models Interest rate risk, on the other hand, is captured by earnings at risk, the approach ... are calculated Finally, the bank replaces the defaulted assets and re-invests matured assets and liabilities At the beginning of t = 2, X2 is drawn At this stage the bank can reprice assets and ... greater than one year for the average US bank, in comparison to 20.7% for the average UK bank (at the end of 2005) The liability side looks more similar for the average UK and US bank For the latter...
- 57
- 1.2K
- 0
APPENDIX A – THE AUDIT RISK MODEL INDEPENDENT AUDITS OF FINANCIAL STATEMENTS pdf
Ngày tải lên :
29/03/2014, 18:20
... them at both the financial statement level and the individual account balance or class of transactions level GAAS also contain a specific requirement that, if control risk is to be assessed at ... day, the objective is to limit audit risk to an appropriately low level, thus enabling the auditor to achieve reasonable assurance that the financial statements are free of material misstatement ... characteristics of the population Audit risk (AR) is the risk that the auditor may unknowingly fail to appropriately modify his or her opinion on financial statements that are materially misstated Audit risk...
- 6
- 458
- 0
báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf
Ngày tải lên :
18/06/2014, 17:20
... satisfaction data at and 18 months using principal component analysis with varimax rotation and Kaiser normalization to ascertain whether the eight factors (Care, Staffing, Development, Relationships, ... all three branches were amalgamated into one dataset Branch was included as an independent variable in the statistical models and was a significant predictor in just one model where working as ... say) Working as a nurse A career chart was used to determine whether or not a respondent was working in a nursing post or as an agency or bank nurse at a particular time-point On the chart the...
- 12
- 530
- 0
Báo cáo hóa học: " Research Article A Stereo Crosstalk Cancellation System Based on the Common-Acoustical Pole/Zero Model" docx
Ngày tải lên :
21/06/2014, 08:20
... loudspeakers to ears are approximated with CAPZ models, then the crosstalk cancellation filter is designed based on the CAPZ model Since the CAPZ model has advantages in storage and computation, the ... by tracking the listener’s head in 3D space The head position is captured by a magnetic or camera-based tracker, then the HRTF filters and the crosstalk canceller based on the location of the listener ... algorithm may accelerate the convergence, but the large computation load is a side effect Although many algorithms have been proposed, the adaptive implementation method remains academic research...
- 11
- 267
- 0
Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx
Ngày tải lên :
11/08/2014, 03:20
... 5'-TG GAATCCTGTGGCATCCATGAAAC -3', Antisense: 5'TAAAACGCAGCTCAGTAACAGTCCG-3'; IFNγ, Sense: 5'-AGCGGCTGACTGAACTCAGATTGTAG CTTGTACCTTTACTTCACTG-3', Antisense: 5'-GTC ACAGTTTTCA GCTGTATAGGG-3' Amplified ... 3'-GUUGUGAGCGACGUUAUAA-5'(antisense) α3 domain 5'-AGGUCUUAUGGUGCUGUCAUU-3'(sense) 3'-UUUCCAGAAUACCACGACAGU5'(antisense) Transmembrane domain 5'-UGUGAUGAAUAGGAGGUGAUU-3'(sense) 3'-UUACACUACUUAUCCUCCACU5'(antisense) ... sense 5'-CGGGATCCCGATGGCTCTAACAA TGCTGC-3', antisense 5'-CGGAATTCCGCTTCGTGTGAAAGTATGGAG-3' The sense primer included the BamH1 restriction site and the antisense primer included the EcoR1 restriction...
- 12
- 287
- 0
Báo cáo y học: "A social marketing approach to implementing evidence-based practice in VHA QUERI: the TIDES depression collaborative care model" docx
Ngày tải lên :
11/08/2014, 05:21
... mental health, and nursing; and clinic managers The audience at a CBOC would be the lead clinicians and administrators At any facility, the desired decision is that the TIDES collaborative care model ... resources that enable the individual to make the behavior change These might include access to educational materials, antidepressant medications, and depression care managers The marketer must then ... integrated healthcare systems, such as the British National Health Service and USA staff model health maintenance organizations, face similar challenges Marketing is a discipline whose core goal...
- 12
- 354
- 0
báo cáo khoa học: " The Washington Needle Depot: fitting healthcare to injection drug users rather than injection drug users to healthcare: moving from a syringe exchange to syringe distribution model" pps
Ngày tải lên :
11/08/2014, 18:21
... interruption The organization did not have to purchase or rent a van; they already had one that was purchased by the health authority They made use of a fully functioning location already funded ... the neighborhood The meeting had a number of outcomes The VCH made it clear that their organization did not want to break the law in any way and agreed to cease operating a fixed needle exchange ... one block away, were presented to the City as part of an argument that no such permit was necessary It increasingly appeared that the demand for a municipal permit was a charade to mask opposition...
- 12
- 458
- 0
Human capital accumulation by low skilled workers with borrowing constraints a welfare analysis based on the lucas rural urban migration model
Ngày tải lên :
16/09/2015, 12:15
... agricultural status may have already resided in urban for many years, they have to choose move back in rural area in future because they are lack of ability to fit the increasing demand for human capital ... constraint and institutional barriers to accumulate human capital Therefore the requirement for migrating into urban and accumulating human capital may be the plausible and powerful explanation ... industrialization process, China’s urban population grew faster and rural-urban migration increased dramatically However, with the command of ”going to the rural and mountainous areas” and the beginning...
- 128
- 292
- 0
The use of credit scoring models and the importance of a credit culture
Ngày tải lên :
04/10/2015, 10:26
... Empresas ICA Sociedad Controladora Grupo Televisa SA Kimberly-Clark de Mexico Telefonos de Mexico SA de CV Vitro SA de CV n .a: not available BBBBB+ BB BB+ Dec 94 n .a AAA BBBABBB AA AAA AAA BB+ ... estimate annual and cumulative defaults 10 Marginal and Cumulative Mortality Rate Equation MMR(t) = Total value of defaulting debt in year (t) total value of the population at the start of the year ... D AAA BBBBBBBB BBB ABB+ B+ BB BBBBBBBBBBBBAAA AAA BB+ A CCC BBB+ BB+ CCCCCC+ AAA AA BB+ BB+ D A B+ BBBB+ BB+ BB BBB+ BB+ BB BBBB+ BB+ BBBBAA A+ BB+ BB CCCB BB CCC B AABBB+ BB+ BB NR/NR/NR Ba2/NR/NR...
- 90
- 917
- 0
Thái độ của sinh viên về thẻ liên kết giữa thẻ ATM của ngân hàng Đông Á-thẻ sinh viên trường Đại Học An Giang
Ngày tải lên :
02/11/2012, 16:40
... kết gồm ba thành phần chính: nhận thức, tình cảm, xu hướng hành vi 4.2 Sự hiểu biết sinh viên kh a trường Đại Học An Giang ngân hàng: DONGA BANK, AGIBANK, VIETINBANK, VIETCOMBANK, TECHCOMBANK, BIDV, ... thẻ ATM-thẻ sinh viên qua phát biểu sau đây: Khi nói đến ngân hàng, Anh/Chị nhớ đến ngân hàng sau đây? (ghi theo thứ tự 1: nhớ đầu tiên, 2: nhớ thứ 2,…) ĐONGA BANK AGIBANK ………… VIETINBANK ………… ... MHBANK Biểu đồ 4.1: Biểu đồ hiểu biết sinh viên ngân hàng 10% 9% 2% 30% 12% 18% 19% DONGA BANK AGIBANK VIETCOMBANK TECHCOMBANK VIETINBANK BIDV MHBANK Mức độ hiểu biết sinh viên trường Đại Học An...
- 17
- 1.1K
- 6
Thái độ của sinh viên trường Đại Học An Giang về thẻ liên kết giữa thẻ ATM của ngân hàng Đông Á-thẻ sinh viên của trường Đại Học An Giang
Ngày tải lên :
05/04/2013, 14:15
... kết gồm ba thành phần chính: nhận thức, tình cảm, xu hướng hành vi 4.2 Sự hiểu biết sinh viên kh a trường Đại Học An Giang ngân hàng: DONGA BANK, AGIBANK, VIETINBANK, VIETCOMBANK, TECHCOMBANK, BIDV, ... thẻ ATM-thẻ sinh viên qua phát biểu sau đây: Khi nói đến ngân hàng, Anh/Chị nhớ đến ngân hàng sau đây? (ghi theo thứ tự 1: nhớ đầu tiên, 2: nhớ thứ 2,…) ĐONGA BANK AGIBANK ………… VIETINBANK ………… ... viên kh a trường Đại Học An Giang Bảng câu hỏi phát cho sinh viên kh a tất khoa trường Đại Học An Giang Sau làm sạch, tổng số hồi đáp 100 đó, khoa 20 bảng, sinh viên nữ 60% nam 40%, sinh viên có...
- 17
- 669
- 0
LÀN SÓNG ĐIỆN ẢNH HÀN QUỐC Ở CHÂU Á THẾ KỶ XXI
Ngày tải lên :
17/04/2013, 10:13
... chạy đua để Yonsama trở thành Junsama Không phải diễn viên đợc sủng nh (theo tin tức từ trang www.bugs.co.kr) Bên cạnh sốt Yonsama, Nhật có sốt Byunsama (cơn sốt hâm mộ Lee Byung Hun), Dongsama (cơn ... Một cho tất cả, Chuyện tình Harvard quay Mỹ, Cô nàng đỏng đảnh quay úc, Chuyện tình Pari quay Pháp, Chuyện xảy Bali quay Inđônêxia, Typhoon quay Hồng Kông, Nga, Thái Lan Có thể kể chuyện hậu trờng ... gũi giống nh gia đình x a tan cảm giác xa cách, kể với khán giả ngoại lai, dù thực tế văn h a Trung Hoa Hàn Quốc có khác (theo trang web www.vnn.net) Theo nghĩ tóm lại đặc điểm sau a tới thành...
- 36
- 619
- 3