... parents mentioned the teaching methods used for SHE and the importance of the quality of teaching They indicated that they want their children to have a comfortable and qualified teacher and are ... respect to several of these topics Although approximately half of parents reported wanting puberty and menstruation to be introduced in grades 6-8, an almost equal percentage of parents wanted them ... There are a number of factors that may prevent parents from providing adequate SHE in the home Many parents are concerned that they not possess sufficient sexual health knowledge to educate their...
Ngày tải lên: 14/02/2014, 14:20
... analysis, and interpretation of data, and drafted the manuscript SR designed, performed, and analyzed the transwell experiments and participated in interpretation of the data and writing of the ... experiments CG participated in acquisition and analysis of the data and drafting of the manuscript AIC conceived the study, participated in its design and coordination, analyzed the data, and helped to ... in the number of synovial T cells might be due either to a lower rate of recruitment or to a higher rate of clearance at the site of inflammation We have previously demonstrated that intra-articular...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: "Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" pdf
... analysis, and interpretation of data, and drafted the manuscript SR designed, performed, and analyzed the transwell experiments and participated in interpretation of the data and writing of the ... experiments CG participated in acquisition and analysis of the data and drafting of the manuscript AIC conceived the study, participated in its design and coordination, analyzed the data, and helped to ... in the number of synovial T cells might be due either to a lower rate of recruitment or to a higher rate of clearance at the site of inflammation We have previously demonstrated that intra-articular...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo y học: " PDZ domain-binding motif of human T-cell leukemia virus type 1 Tax oncoprotein is essential for the interleukin 2 independent growth induction of a T-cell line" ppsx
... found that Tax1 and Tax2 transform a rat fibroblast cell line (Rat-1) to induce colonies in soft agar (CFSA, colony formation in soft agar), and the activity of Tax1 is greater than that of Tax2 ... Domain Binding Motif Tax35 1A EAEV Tax35 3A ETEA Figure Structure of Tax1, Tax2B and their mutant proteins Structure of Tax1, Tax2B and their mutant proteins The amino acid sequence of PBM and its ... ligation Then, wild type tax or tax mutant cDNAs were inserted into the BamHI site of pβAIP Table 1: Characterization of Tax1, Tax2B, and their mutants Tax IL-2 independent proliferation of CTLL-2...
Ngày tải lên: 13/08/2014, 09:21
List the components of a radio system
... enough amplitude to be picked up by the antenna • And for the information to be extracted from it • Electromagnetic interference (EMI) – One factor that affects radio signal strength – Also called ... (continued) 18 Multiple Access (continued) • Code Division Multiple Access (CDMA) (continued) – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder ... is an active device – Must be supplied with electricity • Increases a signal’s intensity or strength – By using the input signal to control a circuit that “shapes” the output • To reflect the...
Ngày tải lên: 13/09/2012, 10:52
Tài liệu Federal Reserve Bank of New York Staff Reports - Why Are Banks Holding So Many Excess Reserves? doc
... opportunities It might be the case, for example, that Bank B is located in an area with a high concentration of firms that actively rely on bank loans or that it has a particular expertise in evaluating ... lower than the rate paid by the central bank The central bank can, therefore, adjust the interest rate it pays on reserves to steer the market interest rate toward its target level The Federal Reserve ... Bank A s reserves have fallen by $60, as have its deposits The balance sheets of the two banks after these transactions have been completed are depicted in Figure Notice that the total amount...
Ngày tải lên: 16/02/2014, 12:20
Flatland: A Romance of Many Dimensions potx
... moment that all our marriages are made So exquisite is the adaptation of Bass and Treble, of Tenor to Contralto, that oftentimes the Loved Ones, though twenty thousand leagues away, recognize at ... aristocratic constitution of the States of Flatland! By a judicious use of this Law of Nature, the Polygons and Circles are almost always able to stifle sedition in its very cradle, taking advantage ... dry and transparent But wherever there is a rich supply of Fog, objects that are at a distance, say of three feet, are appreciably dimmer than those at the distance of two feet eleven inches; and...
Ngày tải lên: 06/03/2014, 12:20
Components of Software Development Risk: How to Address Them? A Project Manager Survey ppt
... managementÐwas expected to affect the capability to handle software risks 2.4 Data Set and Data Analysis We collected a representative data set using a survey instrument by mailing the developed questionnaire ... properties correct, and the estimation of hardware and software capabilities cf ªtechnical riskº [25]) It is also understandable that managing estimates of personnel needs relates to correct system ... evaluation of performance requirements, managing project complexity, and estimation of hardware and software capabilities Poor management of these goes together with a late and uncontrolled peak...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Neuropeptide Y, B-type natriuretic peptide, substance P and peptide YY are novel substrates of fibroblast activation protein-a pdf
... the ability of FAP to cleave known natural DPP4 substrates (Table 1) was then tested at least three times with a MALDI-TOF MS-based assay Representative samples were taken at various relevant times ... natural substrates of FAP are cleaved at endopeptidase sites Denatured type collagen [9,14] and a2 -antiplasmin [11,17] are the only two natural FAP substrates reported In contrast to DPP4, FAP has ... fibroblast activation protein F M Keane et al thought to limit substrate size, but, although the substrate entry channel of FAP is larger than that of DPP4 [16], FAP was unable to cleave the longer...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: The b-N-acetylglucosaminidases NAG1 and NAG2 are essential for growth of Trichoderma atroviride on chitin doc
... nag2-term-rvnest Nag2-cds-fw hph-fw nag2-prom-test-rv ATCAGATGGCGATGTGAAGAG ACCAAGAGTTGAGCCCGTC TCTTGGGCCCTGATACAGACAC AGTTTGGGCCCTGCGAGTTTG TGGCATACAGACTGGGCG AGAACTCGGCTCCATAGGC TTGAAGAAGAGCTGCGAG TGAATGAGGATACACGGG ... mycelial extracts from agar plates that would also reveal any intracellular NAGase activities – suggests that NAG1 and NAG2 are the only two enzymes that possess this activity in T atroviride In accordance ... predominantly extracellular, whereas the majority of NAG2 was apparently attached to the cell walls (data not shown) These results indicate that recycling of GlcNAc via NAG1 and NAG2 during autolysis...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: TioS T-TE – a prototypical thioesterase responsible for cyclodimerization of the quinoline- and quinoxaline-type class of chromodepsipeptides potx
... AS1 5¢-AATATACGTTCGATTAA-3¢ and AS2 3¢-TTATATGCAAGCTAATT-5¢ were synthesized by Operon on a 50 nm scale Annealing of each 5¢-oligonucleotide with its complementary 3¢-oligonucleotide at a final ... showing a mixed substitution pattern of l-Cys3 and l-Met4 Analogous to the results obtained with TL2, TioS T- TE is not capable of catalyzing ligation or macrothiolactonization Total substrate turnover ... catalyst for the in vitro generation of chromodepsipeptide analogs TioS T- TE is the first cyclase to be characterized that is capable of catalyzing macrothiolactonization Additionally, macrolactonization...
Ngày tải lên: 23/03/2014, 06:20
What Changes Are Being Made to Social Assistance Benefits: A Community Perspective on the Impact of these Changes. pdf
... Overall, participants felt that social assistance benefits should be seen as an investment towards the stability and health of our community, not simply as a cost to the community It was agreed that ... As part of background presentations made at the beginning of the meeting, Martha Macfie, staff lawyer with the Legal Centre, told those in attendance that “Municipal government must make hard choices ... relating to health care, dental care, transportation, and housing There are relatively high levels of poverty in Peterborough City and County The area has historically had a high percentage of households...
Ngày tải lên: 24/03/2014, 00:20
Information Technology (IT) Security Essential Body of Knowledge (EBK): A Competency and Functional Framework for IT Security Workforce Development ppt
... Continuity: Evaluate Incident Management: Evaluate IT Security Training and Awareness: Evaluate IT Systems Operations and Maintenance: Evaluate Network and Telecommunications Security: Evaluate ... but not limited to the Gramm-LeachBliley Act, Family Educational Rights and Privacy Act, Health Insurance Portability and Accountability Act [HIPAA], Federal Information Security Management Act ... Security Competency Areas Update awareness and training materials when necessary Communicate management’s commitment, and the importance of the IT security awareness and training program, to the...
Ngày tải lên: 28/03/2014, 20:20
a.e. waite magician of many parts
... insight into the world of Kabbalism'; although he added that 'it is all the more regrettable that it is marred by an uncritical attitude towards facts of history and philology' That failing in Waite ... from that talk with a vague feeling that all this was like a story of which I had heard previously; that it was not strange and new; that it was rooted in the likelihood of things rather than abnormal ... Less partial In a later passage the poet remarks that: 44 _ _ _~ 'LOVETHAT NEVER TOLD CAN BE' Waite helps the boy to realize that ambition, but anticipates with anguish the day of his ordination,...
Ngày tải lên: 30/05/2014, 23:04
flatland a romance of many dimensions sep 2006
... 1926) Of the many modern editions of Flatland, Ian Stewart’s provides the most extensive background information, particularly on mathematical concepts: Stewart, Ian, The Annotated Flatland: A Romance ... to law Seen in the light of such views, Flatland can also be read as an allegory aimed at correcting the arrogance of both the materialist intellect and dogmatic faith and at demonstrating the ... British Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Data available Typeset in Ehrhardt by RefineCatch Limited, Bungay, Suffolk Printed...
Ngày tải lên: 10/06/2014, 21:23
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... feasibility of translating these therapies to humans remains to be assessed One potential limitation of the process is the identification of those antigens that are the most relevant as targets, ... facilitate hematopoietic stem cell transplantation (HSCT) Studies in such patients indicate that Treg cells increase in response to the treatment, and that this effect seems to be increased with ... counterparts localized in the target organ In this latter regard, there is experimental evidence that the blood carries at least a fraction of those cells with undeniable pathogenic potential As...
Ngày tải lên: 18/06/2014, 16:20
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt
... necessitated a small sample size to ensure that the quantity of data remained at manageable levels A point of data saturation was quickly reached – the point at which the researcher felt that increasing ... "We just want, really, a place to live in Because it's hard to start and start and start again, you know' (Clara, Philippines, 30 s) Frustration stemmed from the fact that there was still a nursing ... continues, as some of the migrant nurses whom Ireland actively recruited are recruited once again, this time by Australia, Canada or the United States of America The OECD notes that, despite the...
Ngày tải lên: 18/06/2014, 17:20
The essential qualities of a team player 1 pptx
... important internal partnerships? • What traits of an internal partnership are most important to achieving results? • What are the primary obstacles to effective internal partnerships? • What are the ... winning together • Committed: There are no halfhearted champions • Communicative: A team is many voices with a single heart • Competent: If you can t, your team won t • Dependable: Teams go to go-to ... The 17 Essential Qualities of a Team Player by John C Maxwell • Adaptable: Blessed are the flexible, for they shall not be bent out of shape • Collaborative: Working together precedes...
Ngày tải lên: 07/07/2014, 12:20
The essential qualities of a team player 2 potx
... – Obstacles to Effective Internal Partnerships? • Individuals with attitude that LMI business is not worthwhile • Lack of respect or interest in CRA obligation • Time constraints • Lack of communication ... Governmental entities GSEs Real estate professionals Trade associations Collaboration in Practice • • • • • Specialty lending goals/business plans Homeownership preservation initiatives Employer assisted ... communication • Lack of appropriate follow up • Silos – getting all lines of business to work together simultaneously • Budget • Lack of support staff Survey – Key Issues Related to Achieving Profitable...
Ngày tải lên: 07/07/2014, 12:20
The essential qualities of a team player 3 pot
... Audience referral sources (traditional & non-traditional) Materials designed for use by CRA, CDA & mortgage Objectives provide industry updates, discuss other topics of interest, stimulate ... updates, discuss other topics of interest, stimulate followup “You hit home runs not by chance, but by preparation.” -Roger Maris ...
Ngày tải lên: 07/07/2014, 12:20