... 'The nurse gave her the tablet to take it immediately on the same day although she was not feeling labour pains On the (next day) at about am she felt labour pains and she was given another tablet ... for almost a month and she was treated like someone who was not attending ANC who just came in on labour at the last moment Yet nurses are preaching that people should attend ANC so that they ... Finally, the authors are indebted to the data collectors (Weliswa Binza, Vuyo Magasana, Pumza Mbenenge, Thantaswa Mbenenge, Thoko Ndaba, Nokuthula Radebe), the staff at the ARV clinics and all the respondents...
Ngày tải lên: 10/08/2014, 05:20
... countries but there is little evidence that it is so in practice Accordingly developing countries may require a more complex approach to an LIS than the relatively simple use of the LIS in many ... countries SUMMARY (Vietnamese) FIG t ch c qu c t khác ã ch ng t r ng a (LA) công c c a - H th ng thông tin t (LIS) - óng m t vai trò quan tr ng ph t tri n kinh t xã h i b n v ng c a m t t n c ... ph t tri n nh Hà Lan, Úc, c, Can Na a Thu i n Nhi u nhà t i tr t ch c t i ã h tr n c ang ph t tri n xây d ng h th ng nh v y Các n c ang ph t tri n c ng r t mong mu n có c m t h th ng t ng t ...
Ngày tải lên: 18/10/2013, 14:15
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
... CCTTCCA-3¢, BamHI site underlined) and SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site underlined, XbaI site in italics, HA-epitope ... in an exportcompetent conformation [22] Does TF prevent a premature interaction of Tat substrates with the Tat translocase? It seems conceivable that interaction of nascent Tat proteins with the ... dnaKdnaJ::Kanr thr::Tn10 MC4100DtatA/E MC4100DtatADtatE MC4100DtatB MC4100DtatB MC4100DtatC MC4100DtatC::XSpecr HDB37 MC4100araD pC4Meth-100TorA/ pC4Meth, 94torA/ P2TAG13 P2TAG13 pC4Meth-100TorA/ pC4Meth,...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA ... Tubulin a6 -for Tubulin a6 -rev GAGCTGGAGCCAGTTGAGAAGCAGGG GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC ... not cause increase of acetylated tubulin (Fig 1E), indicating that the acetylation state of tubulin depends mainly on the relative activities of the acetylating and deacetylating enzymes rather...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx
... radiouptake assays JA contributed to the in vitro radiouptake assays AM contributed to protein harvesting and western blot MG was instrumental in statistical analysis of data PZ was instrumental ... and may allow for correlation with efficacy and toxicity during clinical trials and treatment thus offering potential clinical translation of this dual therapy In order to take advantage of the ... paired with hNIS -a3 (5’-GAGGCATGTACTGGTCTGGGGCAGAGATGC3’), and hNIS -a5 (5’-CCCAGACCAGTACATGCCTCT GCTGGTGCTG-3’) paired with hNIS-3 were used in separate PCRs, both with pCRII-hNIS-1 as the template...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: "Short-term locomotor adaptation to a robotic ankle exoskeleton does not alter soleus Hoffmann reflex amplitude" doc
... when adapting to robotic assistance with short term training Instead, our results suggest that mechanisms for this short-term adaptation to the robotic assistance could be decreased excitability ... constant supraspinal inhibition The different sensorimotor calibration after long term training may result from repeated motor adaptation to the robotic assistance [61] During the initial learning ... completed data analysis and drafted the manuscript CLL developed a custom-written program to control the timing of electrical stimuli, assisted with data analysis and helped edit the manuscript DPF...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Interleukin-1 receptor 1 knockout has no effect on amyloid deposition in Tg2576 mice and does not alter efficacy following Aβ immunotherapy" pot
... Representative pictures of Thioflavin-S-stained A plaques (lightly stained areas) decorated with activated astrocytes immunostained with anti-GFAP (brown stain) in the neocortex of untreated (A) ... experimentation Another debate is in regard to the role of microglia activation Several groups report transient or stable enhancements of microglia activation associated with A removal; others not [1,21-23] ... resultant pellet was then extracted in 70% FA, using a probe sonicator, centrifuged at 100,000 g for hour at 4°C, and the supernatant collected (the FA fraction) Extracted A was then measured...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học:" Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" potx
... radiouptake assays JA contributed to the in vitro radiouptake assays AM contributed to protein harvesting and western blot MG was instrumental in statistical analysis of data PZ was instrumental ... and may allow for correlation with efficacy and toxicity during clinical trials and treatment thus offering potential clinical translation of this dual therapy In order to take advantage of the ... paired with hNIS -a3 (5’-GAGGCATGTACTGGTCTGGGGCAGAGATGC3’), and hNIS -a5 (5’-CCCAGACCAGTACATGCCTCT GCTGGTGCTG-3’) paired with hNIS-3 were used in separate PCRs, both with pCRII-hNIS-1 as the template...
Ngày tải lên: 20/06/2014, 03:20
báo cáo hóa học:" Sexual behaviour does not reflect HIV-1 prevalence differences: a comparison study of Zimbabwe and Tanzania" ppt
... Calverton, Maryland: Central Statistical Office and Macro International Inc; 2000 19 National Bureau of Statistics [Tanzania] and Macro International Inc: Tanzania Reproductive and Child Health ... 2005-06 Calverton, Maryland: Central Statistical Office and Macro International Inc; 2007 Page of 21 National Bureau of Statistics [Tanzania] and ORC Macro: Tanzania Demographic and Health Survey ... of the manuscript and interpretation of results ENK, MWM, SM and NS participated in data collection MZC supervised data collection RS participated in data analysis LFS participated in protocol...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo khoa học: " Exposure to genistein does not adversely affect the reproductive system in adult male mice adapted to a soy-based commercial diet" potx
... and prostate of rats, suggesting that estrogen might regulate PHGPx transcription in male reproductive organs Sperm motility is an important factor to maintain fertilization Genistein inhibits ... a 2% agarose gel in Tris- borateEDTA buffer Every sample also tested for RNA integrity by using GAPDH primers: sense primer (5'-AACGG ATTTG GTCGT ATTGG-3), antisense primer (5'-AGCCT TCTCC ATGGT ... trajectory), mean angular displacement (MAD: time-average of absolute values of the instantaneous turning angle of the sperm head along its curvilinear trajectory), lateral head displacement (ALH:...
Ngày tải lên: 07/08/2014, 18:20
Báo cáo khoa học: "A pre-operative elevated neutrophil: lymphocyte ratio does not predict survival from oesophageal cancer resection" pps
... pre-operative staging data, operation type, histopathological diagnosis, staging and survival were extracted from the database Pathological staging was determined using the American Joint Committee ... involving metaplasia (figure 8a &8b) However the majority of gastrointestinal tract cancers not arise as a result of overt acute or chronic inflammation Nevertheless, cancer invokes a host inflammatory ... calculated easily from the data already available NLR and other inflammatory markers have been identified as a predictor of outcome in patients undergoing potentially curative resection for other...
Ngày tải lên: 09/08/2014, 03:21
Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt
... CAAAAGCCTTCATACATC; and for HMGB1, forward ATTGGTGATGTTGCGAAGAA and reverse GATCCACAGCAACTCCAGAA The volume was adjusted to 15.5 μl using RNase-free water, and the mixture was then incubated for ... pathway than the TNF pathway in the pathogenesis of arthritis This theory is also supported by the fact that intra-articular HMGB1 injections cause arthritis in wild-type mice but not in IL-1 type ... the reaction U RNase H (Invitrogen Corporation, Carlsbad, CA, USA) was then added to degrade the RNA After RNase treatment the temperature was increased to 70°C to inactivate RNases All samples...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "T cell Activation does not drive CD4 decline in longitudinally followed HIV-infected Elite Controllers" docx
... observed that most EC have lowlevel viremia detected by assays that are more sensitive than the standard VL assays [27-29] A limitation of the results reported here is that we not have access to sufficient ... Montreal, Quebec, Canada) GraphPad Prism software version 4. 0a was used for graphical presentation and GraphPad InStat version 3.06 for statistical analysis Mann-Whitney and Kruskal-Wallis tests ... for at least year VL was undetectable at the time point immune activation was assessed HIV disease progressors were infected for at least year with evidence of declining CD4 + T cell counts that...
Ngày tải lên: 10/08/2014, 05:22
Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf
... that saturated fatty acids act as agonists for TLR4 Observations from these studies suggested that the saturated fat-induced TLR4 signaling pathway is a likely mechanism linking dietary fat with ... hyperinsulinemia and inflammation in response to diet high in saturated fat [23] Several other investigators proposed that saturated fatty acids act as agonist for TLR4 and therefore linking dietary fat with ... were genotyped using tail DNA extracted with Sigma RedExtract kit from Invitrogen (Carlsbad, CA) Animals were housed at 22°C with an automatically controlled 12-h light and dark cycles A total of...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx
... that saturated fatty acids act as agonists for TLR4 Observations from these studies suggested that the saturated fat-induced TLR4 signaling pathway is a likely mechanism linking dietary fat with ... hyperinsulinemia and inflammation in response to diet high in saturated fat [23] Several other investigators proposed that saturated fatty acids act as agonist for TLR4 and therefore linking dietary fat with ... were genotyped using tail DNA extracted with Sigma RedExtract kit from Invitrogen (Carlsbad, CA) Animals were housed at 22°C with an automatically controlled 12-h light and dark cycles A total of...
Ngày tải lên: 11/08/2014, 06:22
Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps
... chemistries were unremarkable at all time points These results demonstrated that oral inoculation of live attenuated Lmdd and i.v D-ala administration was safe and well tolerated in rhesus macaques ... research was supported by the American Foundation for AIDS Research (amfAR) Grant 02882-32-RGV, National Institutes of Health Grant AI054183 to R.M.R, National Institutes of Health Grant AI078779 ... adult monkeys, indicating limited bacterial invasion into the liver, or complete clearance, by days after boost vaccination Our pilot results warrant the testing of attenuated Lm vectors as part...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: " Ingestion of 10 grams of whey protein prior to a single bout of resistance exercise does not augment " doc
... with Akt suggested to be a key regulator Maximal activation of Akt occurs through phosphorylation of Ser473 and it appears that Akt may have a relatively short period of activation after an acute ... which pathway intermediate activity is affected by the level of phosphorylation at different amino acid sites [14] Specifically, the regulation of translation initiation via the Akt/mTOR pathway ... intra-assay percent coefficient of variation was 7.12% Statistical analyses Data are presented in all tables and throughout the text as mean ± SD Serum IGF and insulin were analyzed using × [Supplement...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: "Development of proteoglycan-induced arthritis depends on T cell-supported autoantibody production, but does not involve significant influx of T cells into the joints." potx
... carried out cell proliferation and ELISA assays AL collected all the data and performed the statistical analyses TTG was involved in study design and carried out the PG immunizations and histological ... lymphoid organs of these mice Discussion Autoimmune diseases are initiated and mediated by autoreactive T cells that can mount a direct attack on the target tissues or act in concert with B cells by ... suggesting that the paucity of these cells in arthritic joints is not a unique feature of PGIA The role of joint-infiltrating T cells in the pathology of RA has been a matter of debate for decades On the...
Ngày tải lên: 12/08/2014, 12:20
Báo cáo khoa học: "nti-L-selectin antibody therapy does not worsen the postseptic course in a baboon model" pps
... treated according to National Institute of Health guidelines A 7F Swan-Ganz catheter (Arrow, Reading, USA) was inserted through the femoral vein and advanced into the pulmonary artery This catheter ... of the current study further support the potential safety of anti-L-selectin therapy in the presence of bacterial infection Interestingly, anti-L-selectin antibody administration was associated ... Commercially available kits were used to measure alanine aminotransferase, creatinine, and total protein (Roche, Basel, Switzerland) or lactate (Boehringer Mannheim, Mannheim, Germany) A Cobas Fara...
Ngày tải lên: 12/08/2014, 23:20
Báo cáo y học: "Generation of a single pulmonary pressure-volume curve does not durably affect oxygenation in patients with acute respiratory distress syndrome" docx
... interests Authors' contributions AR and LP designed the study and drafted the manuscript AR performed the statistical analysis AR, JMF, DD, JMA, SD and MG performed the study All authors read and ... recruitment at inflation but this is followed by an active expiration and by a short disconnection from the ventilator that probably prevents any sustained recruitment Moreover, this active expiration ... measurement using both methods (data not shown) The maximal increase in Pao2 after PV measurement using both methods was not different between patients with diffuse, lobar, or patchy ARDS (data...
Ngày tải lên: 12/08/2014, 23:23