a strategy for dynamic interpretation

Báo cáo khoa học: "A Strategy for Dynamic Interpretation: a Fragment and an Implementation" pot

Báo cáo khoa học: "A Strategy for Dynamic Interpretation: a Fragment and an Implementation" pot

... Idea of Dynamic Interpretation Recent developments in Natural Language semantics have witnessed a shift away from static represen- tation languages towards representation languages with a dynamic ... Netherlands Abstract The strategy for natural language interpre- tation presented in this paper implements the dynamics of context change by translat- ing natural language texts into a meaning ... boldface for the test program Rt~ tn and italics for the formula Rt t t~. We omit outermost parentheses as usual, and use T for a formula which is always true, I for a formula which is always...

Ngày tải lên: 09/03/2014, 01:20

10 366 0
Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt

Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt

... the dynamic mammalian glycome. Proc Natl Acad Sci USA 104, 11534–11539. 14 Tateno H, Uchiyama N, Kuno A, Togayachi A, Sato T, Narimatsu H & Hirabayashi J (2007) A novel strat- egy for mammalian ... MS. Abbreviations AAL, Aleuria aurantia lectin; AFP, a- fetoprotein; GGDB, GlycoGene Database; GlycoProtDB, GlycoProtein Database; GMDB, Glycan Mass Spectral Database; HCC, hepatocellular carcinoma; HV, healthy ... of a human glyco- gene library and comprehensive functional analysis. Glycoconj J 21, 17–24. 2 Kameyama A, Kikuchi N, Nakaya S, Ito H, Sato T, Shikanai T, Takahashi Y, Takahashi K & Narimatsu...

Ngày tải lên: 16/02/2014, 08:20

11 854 0
Connect and Catalyse: A strategy for business innovation 2008-2011 pdf

Connect and Catalyse: A strategy for business innovation 2008-2011 pdf

... innovation and a magnet for innovative businesses, where technology is applied rapidly, effectively and sustainably to create wealth and enhance quality of life. Innovation takes many forms and has ... enables, celebrates and ultimately rewards talent and innovation – and that retains and attracts talented people. The market for talent is global. We have to compete in that market.  Strategy ... departments and agencies. Key application areas We are developing strategies in a number of broad areas representing major societal challenges or associated with the challenge of maintaining...

Ngày tải lên: 06/03/2014, 19:20

24 394 0
A Strategy for Cancer Control in Ireland - National Cancer Forum 2006 pdf

A Strategy for Cancer Control in Ireland - National Cancer Forum 2006 pdf

... appropriate stage in the management of their disease; an enhancement of the palliative care capacity of primary care; integrated care pathways and multidisciplinary teams that incorporate palliative ... National Cancer Strategy. B.2.1 Review of the current status of cancer care Evaluation of 1996 National Cancer Strategy An evaluation of the 1996 Strategy, including a broadly based consultation ... years. 17 A Strategy for Cancer Control in Ireland B.1 Epidemiology Cancer is a major cause of mortality and morbidity in Ireland – it accounts for approximately 7,500 deaths each year, a quarter of all...

Ngày tải lên: 15/03/2014, 00:20

68 392 0
E-Commerce and Consumer Goods A Strategy for Omnichannel Success doc

E-Commerce and Consumer Goods A Strategy for Omnichannel Success doc

... Kong Mumbai Seoul Shanghai Taipei Tokyo Australia, New Zealand & Southeast Asia Bangkok Brisbane Canberra Jakarta Kuala Lumpur Melbourne Sydney Europe Amsterdam Berlin Copenhagen Düsseldorf Frankfurt Helsinki Istanbul London Madrid Milan Moscow Munich Paris Rome Stockholm Stuttgart Vienna Warsaw Zurich Middle ... digital marketing organizations. A dedicated team offers enhanced focus, a means of nurturing new talent, and greater transparency and accountability for decision making. This alternative ... Lumpur Melbourne Sydney Europe Amsterdam Berlin Copenhagen Düsseldorf Frankfurt Helsinki Istanbul London Madrid Milan Moscow Munich Paris Rome Stockholm Stuttgart Vienna Warsaw Zurich Middle East Abu Dhabi Beirut Cairo Doha Dubai Riyadh North America Atlanta Boston Chicago Cleveland Dallas DC Detroit Florham...

Ngày tải lên: 16/03/2014, 11:20

16 267 0
Integrating Gender into the World Bank’s Work: A Strategy for Action potx

Integrating Gender into the World Bank’s Work: A Strategy for Action potx

... THE STRATEGY 31 THE STRATEGY 23 Box 2.2 Good Practice Example: Integration of Gender Analysis into a World Bank Country Assistance Strategy and Analytical Work A high-quality Country Gender Assessment ... mobilize additional multilateral and bilateral financing, and (ii) organize Consultative Group meetings for specific countries. The Bank also promotes collaboration with inter- national, national, and ... development actions, and who can act as focal points for coordinating efforts such as fundrais- ing, are needed to support gender mainstreaming. Such technical specialists are particularly important...

Ngày tải lên: 22/03/2014, 21:20

92 360 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC JH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCGTGGTCCC L. ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC VK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC VL1.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC VL 3a. link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC VL4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC VL5.link...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Auditing for Social Change: A Strategy for Citizen Engagement in Public Sector Accountability docx

Auditing for Social Change: A Strategy for Citizen Engagement in Public Sector Accountability docx

... processes. Taking HIV/AIDS programs as a case study, UNDESA has found that legislative auditors at national and sub-national levels, as well as internal auditors of ministries and institutions, have ... Auditing Manual, Office of the Auditor General of Canada, August 1990 58 Auditing for Social Change for accounting and for auditing being formulated. But here again most develop- ing countries are not ... to take innovative steps to expand the pool of personnel available to serve on the PAC • Special attendance allowances, rather than a special salary, should be con- sidered for PAC attendance •...

Ngày tải lên: 30/03/2014, 02:20

220 373 1
Báo cáo khoa học: "A FOUNDATION FOR SEMANTIC INTERPRETATION " pot

Báo cáo khoa học: "A FOUNDATION FOR SEMANTIC INTERPRETATION " pot

... based on that of Marcus (1980). Unlike Marcus's parser, Paragram has two types of rule: base phrase structure rules and transformational rules. It is also able to parse un- grammatical ... then throw away any that don't make sense to the database. If'Our choice of Paragram was largely pragmatic~it w&s avL/l- • ble and does not represent &ny particular commitment ... transformational g~ammar s. based on message passing, with the goal of running syntax and semantics in parallel and providing seman- tic feedback to the parser. A ~moderator" trans- lates...

Ngày tải lên: 31/03/2014, 17:20

10 390 0
ukraine's trade policy. a strategy for integration into global trade. washington, 2005

ukraine's trade policy. a strategy for integration into global trade. washington, 2005

... efficient and effective conformity assessment system. Standard compliance is an important element of export diversification strategy. Standards serve as a catalyst for technical and adminis- trative change, ... percent). xv Abbreviations and Acronyms ACP African, Caribbean, and Pacific countries AMS Aggregate Measure of Support CEE Central and Eastern Europe CEEC Central and Eastern European countries CED ... countries. The analysis suggests that the primary constraints to export expansion and diversifica- tion in Ukraine are internal, and relate to conventional domestic factors such as a weak pri- vate sector and...

Ngày tải lên: 04/06/2014, 17:32

269 282 0
Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx

Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx

... experimen- tal trials. JD also participated in the analysis of the results and preparation of the manuscript. AS participated in the experimental trials, were responsible for the statistical analysis and ... expec- tations to motion sickness symptoms and gastric activity. J Psychosom Res 2004, 56:721-726. 10. Sugita N, Yoshizawa M, Abe K, Tanaka A, Watanabe T, Chiba S, Yambe T, Nitta S: Evaluation of adaptation ... in a driving simulator that was in accordance with the vestibular and visual information perceived [22]. This visual-based artificial horizon reduced perceptual errors and also reduced balance...

Ngày tải lên: 19/06/2014, 08:20

9 610 0
Dự án nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed (Milestone 7) " potx

Dự án nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed (Milestone 7) " potx

... compilation and analysis of available secondary data; • documentation of activities for the training manual; and • planning for future training activities for 2 CAP staff at UWA associated with ... hoped that arrangements will be able to be made for training of CAP staff at SARE as planned during July/August 2009. This training will focus on advanced analysis of the data, and finalisation ... month period and the period after has been heavy, particularly for the CAP team. Dr Donna Brennan has taken maternity leave from January to May 2009 inclusive. This will mean a delay in the...

Ngày tải lên: 21/06/2014, 04:20

12 529 0
Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed " docx

Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed " docx

... implementation date of 1 st May 2007. Australian team planning meetings commenced at UWA on a regular basis from the second week of May, and joint planning by the Vietnamese and Australian teams for ... labors Data collected is suitable for the objectives of the research Quantitative description of the supply chain for animal feeds in Vietnam Secondary data are relevant and available ... 10 Australian team. The Australian team met with the IPSARD/CAP team during August 2007 to discuss and investigate issues relevant to the training manual such as: • Tangible outcomes...

Ngày tải lên: 21/06/2014, 04:20

19 498 1

Bạn có muốn tìm thêm với từ khóa:

w