... them Zymomonas mobilis (Mazaheri, Shojaosadati et al 2012; Wirawan, Cheng et al 2012; Chandra, Abha et al 2013), Saccharomyces cerevisae (Zaldivar, Roca et al 2005; Sindhu, Kuttiraja et al 2011; ... Dr Satyen Gautam, Dr Karthiga Nagarajan, Dr Vivek Vasudevan, Dr Cheng Xiyu, Ms Phay Jia Jia Two other labmates I would like to mention specially ii are Dr Prashant Praveen and Ms Vu Tran Khanh ... research, the SHFMB was used to simultaneous saccharification and co-fermentation of Jatropha curcas fruit hull at high solid loadings for high ethanol titer Jatropha curcas fruit hull slurry obtained...
... aqueous and an organic phase for non-dispersive solvent extraction has been a widely investigated research area (Ana Maria and Anil Kumar 2008; Asimakopoulou and Karabelas 2006; Cichy and Szymanowski ... combines the advantages of both extraction and adsorption resulting in high cell growth and biodegradation rates On the other hand, liquid NAPs have the advantages of easy handling, high partition ... the solvent has a high viscosity Agitation rates as high as 600 RPM have been reported during pyrene biodegradation using silicone oil as the organic phase (Mahanty et al 2008), which may be difficult...
... concentration in the AS-SHFMP can be as high as 2.5 g/L, ix significantly higher than the microalgae concentration in the high rate algal pond (HRAP) systems In conclusion, this study has facilitated ... crustaceans and fish The most frequently used species in aquaculture are Chlorella, Tetraselmis, Isochrysis, Pavlova, Phaeodactylum, Chaetoceros, Nannochloropsis, Skeletonema and Thalassiosira (Apt ... biomass for the production of human and animal nutrition, and other high-value added chemicals This is because microalgae can accumulate lipid, protein, and carbohydrate with percentages are similar...
... distillation systems, Desalination, 299 (2012) 5562 [50] J .A Prince, G Singh, D Rana, T Matsuura, V Anbharasi, T.S Shanmugasundaram, Preparation and characterization of highly hydrophobic poly(vinylidene ... porosity as high as 80% and thickness smaller than 50 µm were fabricated, which enhanced the MD performance dramatically Companies and orgaizations like Gore and Associates (USA), Swedish Development ... [3] The plasma modification increased the contact angle of the membranes to around 120º The authors also reported the stable membrane performance with no leakage and high salt rejection Cheng and...
... and are 12 available At a higher NaCl concentration, the membrane seems to have a larger calculated charge density The effective charge density, X, can be related to the NaCl concentration ... sustainable pharmaceutical manufacture Pharmaceuticals have been making significant contributions to the healthcare of human beings over the past number of decades However, recently there is a ... nanofiltration performance AFM images demonstrate that a high take-up speed favors the “spinodal decomposition” rather than “nucleation and growth”, which increases surface porosity and thus increases...
... while these macro-voids are apparently eliminated or suppressed when the shear rate increases to 2436 s-1[29] It is clear that high shear rates change the precipitation path and retard the macrovoid ... the inherent chemical and physical properties of the membrane material are very important for membrane formation A good membrane material should possess a reasonably large molecular weight and ... extrusion as the shear rate increases [30] Both the sizes of the nodules in the fiber spinning and transversal directions decrease with increasing shear rate possibly because of the chain disentanglement...
... with reasonably good mechanical strength and high adsorption capacity for heavy metal ions However, a practical problem arising from this method was the high viscosity of the dope solutions that ... opposite charge with that on the membranes can pass through the membranes while those with the same charge are rejected A typical example of such process is electrodialysis In fact, some membrane ... ultrafiltration and nanofiltration are the typical membrane processes utilizing the size exclusion mechanism Another mechanism is the sorption-diffusion mechanism, where components that have higher affinity...
... inorganic film is subjected to high-energy particle radiation applied perpendicular to the film The film is then immersed in an acid or alkali bath to etch away the materials along the tracks The ... is based on the charge characteristics of the components to be separated In such process, the membranes are electrically charged and only species that have the opposite charge with that on the ... because of the fast phase separation rate on the membrane surface since a high amount of nonsolvent is immediately available near the surface In the sublayers of the membranes, large voids are...
... polymer chains after thermal annealing Clearly, the annealed PBI/POSS-PAN/PVP dual layer membrane is significantly stronger than the PBI-PBI fiber and can greatly expand the practical applications ... Cost-effective and mechanically strong dual-layer hollow fibers Comparing to single-layer membranes, dual-layer membranes have two major advantages Since most functional materials for separation are much ... Using this method, we can choose a material with good chlorine resistance and salt rejection properties as the selective layer and a cheap but mechanically strong polymer as the substrate layer...
... facilitated the crosslinking reaction, while a high-temperature heat treatment caused the reaction reversed The separation factor was further enhanced after heat treatment with a loss in flux Jiang ... autoclave Ceramic membranes show high water permeation flux and relatively high separation factor for alcohol dehydration [65] The major drawbacks of inorganic membranes are (1) the higher cost ... vapor permeate at each side of the membrane Different from other membrane processes, pervaporation has the phase change across the membrane [10-12] Figure 1.1 illustrates the schematic diagram...
... 5¢-AGACTTTCAAACGAATAATAACTT CAGCAATAAAAATTGTCCAGGTTAATtccagcgacatg gaggccc-3¢ and 3¢ATF2-Kan: 5¢-TTGTACGAGCTCGG CCGAGCTATACGAAGGCCCGCTACGGCAGTATC GCAcattcacatacgattgacgc-3¢ (nucleotides in lower case are specific to the ... cactaaattaataatgaccggatcATGTACTTCCCCTTTTTAGG CAGAT-3¢) and lip2 (5¢-cagtagagacatgggagatcccccgcgg aattcgagctcggtacccgggTCATTCTTTATTTAGAGCATC CAGC-3¢) The sequences in lower-case are complementary ... (Table 1) The APAT-deficient strain, CA14, was generated by disrupting the ATF2 gene of CA10 with the KanMX4 cassette, which confers G418 resistance Primers 5¢ATF2-Kan 5¢-AGACTTTCAAACGAATAATAACTT...
... The thoughts he has offered have enriched my thesis a lot The things I have learned from him are never just only the sense of research but the mission for ‘never give-up’ and many others Apart ... Purge gas Syngas ratio adjustment CO2/ Hydrocarbons Acid gas treatment, landfill gas upgrading H2 O/ Hydrocarbons Natural gas dehydration H2 S/ Hydrocarbons Sour gas treating He/ Hydrocarbons Helium ... et al., 1964) They can therefore achieve both high flux and sufficient mechanical strength The flux of the asymmetric membranes invented by Loeb and Sourirajan was at least tenfold higher than...
... the reactor High agitation rates have to be maintained to keep the particles afloat and their surface area exposed for adsorption Maintaining high agitation in large scale industrial applications ... formation, density difference between the aqueous phase and NAP should be high; this constraint narrows down the choices of available NAPs This is especially the case when polar pollutants are ... they are washed thoroughly and dried using blotting paper or tissue paper (Burghoff et al., 2010) Figure 2.3 shows a schematic diagram of a SIR particle and the extraction mechanism where S and...
... To the JIBES, thank you for making life outside the lab and lecture memorable. To Patricia, who has been my life raft these past 2 years; to Casey, Mad, Ed, Sukriti, Hanwern, Neisha, and Ashley, thank you for all the fond ... PDNS is a fatal but sporadic disease first recognized in 1993 and affects pigs 12‐14 weeks of age (Chae, 2005). It has been reported in Asia and North America and is characterized by the appearance ... treated with the drugs for 6 hours after overnight infection with PCV2 2. 5 Generation of Graphs and Statistical Analyses Graphs and statistical analyses were generated using GraphPad Prism ver. 5.04 (GraphPad Software, San ...
... would be amenable to HTS. A Z’ factor of > 0.5 indicates amenability for HTS, while a value between 0 and 0.5 indicates faulty reagents or suboptimal assay, and a negative value indicates that the assay results to variable data and not amenable for HTS (Inglese et al., 2007; Sui and Wu, 2007). Z values for ... Another parameter for assessing assay robustness and repeatability is the Z’ factor (Zhang et al., 1999; Sui and Wu, 2007). Since it takes into consideration the variability of values both from the control ... that could effectively inhibit PCV2 replication and this study was aimed at addressing this issue through the establishment of a primary screening assay in an effort to facilitate drug discovery against PCV2 replication. The assay was developed by monitoring the expression of Rep protein through IFA to assess ...
... dimensions and embedded in one another In this setting, there are no unique transient and partially relaxed phases, but rather a cascade of as many phases as timescales, with each consecutive phase ... QSSA manifold on their way to the steady state, which is an indication that the former is closer to a SIM than the latter Using these plots and having measured the concentration of EIIAặP, the ... molecules, as is the case, for example, in metabolic pathways However, as cell biology has developed, attention has shifted away from major metabolic pathways to pathways of gene expression and signal...
... value a highly similar) parse even if the training data is somewhat changed In other words, we rely on the stability of the parameters of statistical parsers Although this is not always the case, ... to predict the quality of a parse The higher the agreement, the higher the quality of the parse Our approach assumes that if the parameters of the model are well designed to Recall that sentence ... f-score than SEPA, the filter precision of SEPA is much higher (right, shown for adaptation The indomain pattern is similar and not shown) This stems from the definition of the MR baseline, which simply...
... described The combination of the bursting of the housing bubble and the world financial crisis has had a substantial impact on the endowment of labour and capital in Ireland This has served to permanently ... effects of higher inflation on wage rates as employees bargain to protect their real after-tax wage However, the simulation results indicate that wage rates could actually be below that of the Baseline ... farm relative to the Baseline Scenario Table presents the key parameters and assumptions for the financial analysis There are twin sets of parameters for certain variables which vary under the...
... these drawbacks Chan et al [16] have proposed a two-phase algorithm In the first phase an adaptive median filter is used to classify corrupted and uncorrupted pixels In the second phase, specialized ... Structure Similarity Index, and Image Enhancement Factor and Computational time Both visual and quantitative results EURASIP Journal on Advances in Signal Processing are demonstrated The results show ... coefficients can be determined from autocorrelation of the available data where signal model is not available This is a reasonable approach in realistic situations [18] Let x(n) be a prediction...