a shallow clone of a single branch

... Isrina Oktavia Salasia et al reactions and with a commercial grouping kit (Slidex Strepto-kit bioMerieux, Nürtingen, Germany) The growth pattern of the bacteria in fluid media and the morphology of ... and with compact colonies in soft agar The growth properties of these three bacteria obtained from the original outbreak had already been described [15] According to studies of Abdulmawjood and ... (Biolabs, Schwalbach, Germany) [1] The preparation and SmaI digestion of the chromosomal DNA for macrorestriction analysis of the isolates by pulsed-field gel electrophoresis was performed as described...

Ngày tải lên: 07/08/2014, 18:20

... Billinton and C Singh, ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans on Power Apparatus ... Enumeration of Minimal Cutsets Separating Vertices in a Class of Undirected Planar Graphs," IEEE Trans on Reliability, Vol 41, No 1, March 1992 Li Yan, Hamdy A Taha, Thomas L Landers, "A Recursive ... Minimum cutset No Branch # Branch # Minimum cutset No Branch # Branch # Minimum cutset No Branch # Branch # Minimum cutset No Branch # Branch # Minimum cutset No Branch # Branch # 2 10 11 12...

Ngày tải lên: 03/01/2014, 19:35

... analysis of the DNase I family The mammalian group formed a relatively tight cluster, while the snake (E quadrivirgata, E climacophora and A blomhoffii), amphibian (X laevis, Rana catesbeiana, ... Yasuda, T., Sawazaki, K., Nadano, D., Takeshita, H., Nakanaga, M & Kishi, K (1993) Human seminal deoxyribonuclease I (DNase I): purification, enzymological and immunological characterization and ... obtained from the Japan Snake Institute, Gunma, Japan Phenyl Sepharose CL-4B, DEAE Sepharose CL-6B and Superdex 75 were purchased from Amersham Pharmacia Biotech; Concanavalin A (Con A) agarose...

Ngày tải lên: 20/02/2014, 23:20

... Data cessing, where scores of 90% or above are not uncommon for tasks such as part -of- speech tagging and statistical parsing, this can be at least partly explained by the fact that humans vary ... trigram POS This particular trigram would not have been found by the language model; after a backchannel backing-off was applied, forcing the language model to count the pause as a unigram ... Interactional units in conversation: syntactic, intonational and pragmatic resources for the management of turns In E Ochs, E A Schegloff, and S A Thompson, editors, Interaction and Grammar, chapter...

Ngày tải lên: 22/02/2014, 02:20

... anesthesia workload and that a typical epidural takes about half the time of a typical cesarean Accordingly, the OAAI for each hospital was calculated as ((0.75 * number of epidurals per year) + (1.5 ... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per yr ... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data...

Ngày tải lên: 05/03/2014, 15:20

... ‘punctae’ and aggregates near the plasma membrane [1,6] The N-terminal region of STIM1 contains a canonical EF-hand motif and a predicted SAM domain Stathopulos et al [23,24] isolated the EF-SAM ... via a short antiparallel b-sheet Ca2+ is coordinated by the mainchain carbonyl and side-chain carboxyl oxygens at the 12- or 14-residue loop One pair of EF-hands usually forms a globular domain ... conformational changes in this motif The Ca2+ signal change and the accompanying conformational change in the canonical EF-hand are probably relayed to the SAM domain via the paired ‘hidden’ EF-hand, resulting...

Ngày tải lên: 07/03/2014, 00:20

... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢...

Ngày tải lên: 07/03/2014, 12:20

... GAT GGA TCC TGC CAC TGA CGT CCT ATT TTA ATA CTC C-3¢, and Acod (reverse): 5¢-CGC GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA GT-3¢, and the EcoRI restriction fragment of the chloroplast ... mutants because they lack variable fluorescence – a signature of the absence of PSII [15] – but have a low (instead of a high) fluorescence yield This unusual feature was attributed to a major change ... It was subsequently proven that changes in supramolecular organization of the peripheral antenna were due to the absence of one particular fatty acid, C16:1(3t), which probably causes a decrease...

Ngày tải lên: 07/03/2014, 15:20

... monosaccharide sequence and branching pattern Characterization of the Kdo-lipid A- OH region ESI-MS data (Table 1), fatty acid compositional analysis (yielding 3-hydroxytetradecanoic acid) and ... et al [28] The total content of fatty acids was analysed as described previously [29] Results Characterization of LPS Chromatography Gel filtration chromatography and GLC were carried out as described ... various alditol acetates and partially methylated alditol acetates obtained in sugar- and methylation analyses correspond to the detector response of the GLC-MS Permethylation of dephosphorylated...

Ngày tải lên: 08/03/2014, 02:21

... inactivation of soluble and immobilized penicillin amidase from E coli Kinetic analysis and titration of active site Bioorg Khim 3, 547–553 2598 25 Yamagami C, Takao N, Tanaka M, Horisaka K, Asada ... biphasic character of the Hammett plots available for AGA and GGT, it was suggested that the breakdown of the tetrahedral structure proceeded via general acid catalysis, whereby the proton transfer ... Perakyla M & Kollman PA (1997) A simulation of the catalytic mechanism of aspartylglucosaminidase using ab initio quantum mechanics and molecular dynamics J Am Chem Soc 119, 1189–1196 Liu Y, Guan...

Ngày tải lên: 16/03/2014, 01:20

... isolated DNA was extracted with phenol and chloroform, precipitated with ethanol and Na-acetate, and resuspended into water Total cellular DNA was also alternatively isolated with QIAamp DNA Blood ... Nishizawa T, Kato N, Ukita M, Ikeda H, Iizuka H, Miyakawa Y & Mayumi M (1998) Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusion hepatitis of unknown ... Miyata H, Tsunoda H, Kazi A, Yamada A, Khan MA, Murakami J, Kamahora T, Shiraki K & Hino S (1999) Identification of a novel GC-rich 113-nucleotide region to complete the circular, single- stranded...

Ngày tải lên: 16/03/2014, 05:20

... (5¢-ATG AAAGTTCAAGAGAAGATCAATCTC-3¢); ELM99 (5¢ATGAGGGGTGCTATGAAGATCAAGG-3¢); ATL100 (5¢-ATTAGGGGTGCGCTGAAGATCAAGG-3¢); ATL14L15F18 (5¢-AAATCCGATGCAATCCTGGACCTGCTG AAGGAATTTCTTTCCACCGACGCC-3¢) For ... palmitic acid to the sample The values are mean ± SD from at least four different analyses Plant Type Ergosterol Palmitic Acid E lagascae E lagascae E lagascae E lagascae A thaliana A thaliana ... was amplified from E lagascae cDNA by the use of primers SCPElNE (5¢-ACTGGAATTCAACT CAAGTCCCAAAATATTTTGGAT-3¢) and SCPElCN (5¢-TCATGGCGGCCGCTCACAGCTTCGACGGCTTGG GGAA-3¢) The PCR fragment obtained...

Ngày tải lên: 16/03/2014, 12:20

... effect of a mechanical force on the kinetics of chemical reactions A recent review by Beyer and Clausen-Schaumann describes the role of mechanical forces in catalyzing chemical reactions.[48] The authors ... experiments All data was obtained and analyzed using custom software written for use in Igor 5.0 (Wavemetrics, Oswego, OR) There was approximately 0.5 nm of peak-to-peak noise and a feedback response ... the gap between separating b-strands In Figure B, we define the pulling coordinate for the A and G b-strands as the distance between the first amino acid of strand A (Y9) and the last amino acid...

Ngày tải lên: 22/03/2014, 18:20

... Collinge AJ (1974) Occlusion of the septal pores of damaged hyphae of Neurospora crassa by hexagonal crystals Protoplasma 80, 57–67 19 Yuan P, Jedd G, Kumaran D, Swaminathan S, Shio H, Hewitt D, Chua ... bodies of N crassa are smaller with an average size of 2934 To corroborate the appearance of hexagonal HEX1 structures in BY4742, this strain was also analyzed by electron microscopy The untransformed ... secondary antibodies applied were obtained from Molecular Probes (Alexa Fluor 594 goat anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse IgG) Acknowledgements We thank F Nargang for the N crassa...

Ngày tải lên: 23/03/2014, 07:20

... of the original TetR instead of TetR-transactivator fusion proteins As clonal isolation is unnecessary and because of efficient episomal propagation of the Epstein–Barr vector, our approach saves ... Fig 2) Relative background transcription was calculated from the ratios of signals for transporter mRNA and GAPDH mRNA With OCT1, OCT2, and CAT4 both vectors were analyzed alongside on a single ... interface is ATGCCTGC GGGGATCCAC TAGTAACGGC CGCC AGTGTG CTGGAATTCT GCAGATATCC ATCACAC TGGCGGCC The cDNA of eGFP corresponds to GenBank entry U57609 For pEBTet ⁄ eGFP, the 5¢ interface is GGTACCG...

Ngày tải lên: 23/03/2014, 09:21

... Immunoprecipitation and SDS/PAGE Materials and cell lines The mAbs V.1 and V.5 against GPV, ALMA.12 against GPIba, ALMA.16 against GPIX and RAM.1 against GPIbb, were developed in our laboratory [19] ... presence of increasing concentrations of methotrexate Analysis of permeabilized cells by confocal microscopy revealed an intracellular pool of GPV with a granular appearance (Fig 1B) Analysis of culture ... Strassel, C., Baas, M.J., Salamero, J., ChasserotGolaz, S., Cazenave, J.P., De La Salle, C & Lanza, F (2001) Biosynthesis and intracellular post-translational processing of normal and mutant platelet...

Ngày tải lên: 23/03/2014, 13:20

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

... depolarizations from a holding potential of )72 mV to a test potential of )7 mV (A and C) Maximum amplitude of the Na+ current activated by each depolarization is plotted against time, after ... depolarizations activate no measurable inward current after steady-state blockade by TTX B and D show that Na+ current reaches peak amplitude approximately 0.3 ms after the beginning of each depolarization, ... of South African Scorpion Parabuthus transvaalicus (Buthidae) Eur J Biochem 268, 5407–5413 Hidaka, S & Ishida, A. T (1998) Voltage-gated Na+ current availability after step- and spike-shaped conditioning...

Ngày tải lên: 31/03/2014, 08:20

... One microgram of total RNA was annealed with an oligo(dT) primer and the first strand cDNAs were synthesized with avian myeblastoma virus (AMV) reverse transcriptase (Takara Biomedicals) at 45 °C ... shown in Fig 3A, a major band with a molecular mass of  140 kDa was detected by aF-N in WCL (lane 1), as well as a minor band of  100 kDa The size of the former was almost equivalent to the ... used as a marker for cytoplasmic extraction The same membrane was used for immunoblot analysis with aF-N, aF-C and anti- (a- tubulin) Ig Lanes and 4, whole cell lysate; lanes and 5, cytoplasmic fraction;...

Ngày tải lên: 31/03/2014, 23:20

Ngày tải lên: 24/04/2014, 17:23