a record missing in the secondary file jdftval keyword specified
Natural botanical products have a long history in the world and are featured in using a complex
Ngày tải lên :
03/11/2012, 09:54
... Streptavadin (LSAB kit, DAKO) for 60 min, and further incubated with hydrogen-peroxidasediaminobenzidine (H2O2-DAB) to visualize the PCNA-positive cells Finally, they were counterstained with Mayer’s ... daily for 14 and 28 days Tumor areas were measured every days using a caliper, and the tumor area was calculated according to the formula: tumor volume (mm3) = d2 x D/2, where d and D were the ... compounds including lunasin and lectins that were shown to induce apoptosis in malignant cells [13] As CKBM contains these compounds, this would partially explain why it inhibits tumor growth in the...
- 9
- 712
- 0
A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA
Ngày tải lên :
05/09/2013, 09:08
... identifying the areas that discharge high pollutant loading into receiving waters METHODS Our area of interest was Marina del Rey and its vicinity in the Santa Monica Bay Watershed Santa Monica Bay ... were classified as transportation land use in the SCAG data and USGS classification system Vegetated areas inside the institutional areas were also identified as low pollutant loading areas, which ... with official land used data obtained from SCAG land use data The pollutant loading maps of all water quality parameters show that the low pollutant emitting areas correspond to open land use due...
- 7
- 575
- 0
Focus - A simplicity manifesto in the Age of Distraction
Ngày tải lên :
05/01/2014, 15:25
... and making you want to the activity again, as soon as possible You get the positive reinforcement again, and again, and again, in a constant cycle of positive reinforcement, and soon you’re addicted ... inspiration in what others have done, you get ideas, you gather the raw materials for creating But consuming and communicating aren’t creating They aid creating, they lay the groundwork, but at some point ... general idea Again, start with half a day or a day — something manageable Do it once a week, and gradually expand the time you spend on the cleanse Reducing the Stream If you’ve done the cleanse,...
- 121
- 552
- 1
Tài liệu SOCIAL MEDIA AND BRAND AWARENESS - A CASE STUDY IN THE FAST MOVING CONSUMER GOODS SECTOR docx
Ngày tải lên :
18/02/2014, 08:20
... branding, and means that rather than broadcasting messages to audiences and target groups, in the era of social 10 web that we live in today, branding and marketing is about participating in ... fram att utmaningen ligger i att vara relevant i sociala medier och i alla andra kommunikationskanaler, vilket handlar om att hitta den räta balansen mellan att presentera intressant material ... reading and rereading the data files, creating and assigning codes This is not distinct from data analysis, as the act of coding data will give rise to insights as to patterns in the phenomena...
- 54
- 684
- 0
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
Ngày tải lên :
21/02/2014, 01:21
... estimated by the Whiteman Alcian blue binding technique [28,29], using chondroitin sulfate as standard The assay was adapted to the estimation of GAG in more dilute samples by increasing the aliquot ... 269) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre Sulfated and nonsulfated ... (6.5%) Thus, the alanine and glycine Fig Anion exchange-HPLC elution profiles of the water-soluble matrix (A) and the EDTA-soluble matrix (B) of Pinctada maxima nacre Samples (55 lL) containing 400...
- 10
- 731
- 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
Ngày tải lên :
21/02/2014, 03:20
... Fig 3A showing only the rates obtained in the absence of a Du In this case, the impairment of the ATP synthesis rates in the mutant was higher than twofold, especially in the low DpH range Again, ... concentration in each sample was measured in a luminometer (LKB 1250) with the ATP-Monitoring Kit (Bioorbit) The small amount of ATP synthesized in the dark (due to the adenylate kinase reaction) was ... mutation aE210K was introduced into the atp2 operon of Rb capsulatus, containing the F0 genes, cloned in an E coli strain The mutated operon was then transferred into a broad-host-range vector and the...
- 9
- 580
- 0
Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc
Ngày tải lên :
21/02/2014, 08:20
... at Metz In the meantime we taught him, at the same place, the manual of arms and Infantry tactics which had been introduced into the army after he was graduated at the Military Academy In practical ... to chaparral | | Page 20 relinguished changed to relinquished | | Page 21 chapparal changed to chaparral | | Page 22 chapparal changed to chaparral | | Page 27 chapparal changed to chaparral | ... works Nearly all the individual works in the collection are in the public domain in the United States If an individual work is in the public domain in the United States and you are located in the...
- 48
- 504
- 0
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx
Ngày tải lên :
24/02/2014, 18:20
... for parents to support the learning of languages other than English through a play based approach Contact the Playgroup Association for further information Maintaining the ... Association, Richmond, Victoria, Australia Nyakatawa, S and Siraj-Blatchford, I 1994, ‘Bilingualism, biculturalism and learning in Early Years Classrooms’, in Blackledge, A (Ed), Teaching bilingual ... • playing picture lotto, bingo and card games, using two languages or playing in a language other than English 11 Supporting Children Learning English as a Second Language in the Early Years...
- 31
- 1K
- 2
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
Ngày tải lên :
07/03/2014, 12:20
... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢...
- 16
- 397
- 0
HOW TO START A HEDGE FUND IN THE EU 2012 ppt
Ngày tải lên :
07/03/2014, 16:20
... maintain themselves and the members of their family without recourse to the social assistance system in Malta; iv reside in accommodation regarded as normal for a comparable family in Malta and ... particularly in the regulated industries of financial services and internet gaming, has created a marked shortage in the supply of certain specialised skills within these industries These growing pains ... mitigate them while building a viable business In other words, the manager has to comfort the investor that he knows what he is doing and that the risks they are buying are all in the strategy and...
- 24
- 545
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
Ngày tải lên :
08/03/2014, 09:20
... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial ... of the targeting signal is the parameter discriminating between SRP-dependent and SRP-independent pathways [14] On the other hand, in vitro cross-linking studies have revealed that the binding ... SDS/PAGE [32] and visualized by autoradiography In vitro transcription, translation, targeting and cross-linking analysis To generate truncated mRNA, plasmids (Table 1) encoding truncated nascent...
- 8
- 546
- 0
Báo cáo " Community based coastal resources management behind changes in surface water environment and land policy: A case study in the Tam Giang Lagoon, Central Vietnam " ppt
Ngày tải lên :
14/03/2014, 15:20
... based and comanagement institutions for sustainable coastal fisheries management in Southeast Asia Ocean & Coastal Management, Vol 27, No 3, pp 143 Ton That Phap, 2002 “Co-management in the planning ... exploiting, the provincial government and related agencies have promulgated many decrees and regulations in order to manage the lagoon’s resources The remarkable documents are indicated in the Table ... management, Hue, Vietnam Rivera, R .A, 1997 Re-inventing power and politics in coastal communities: community based and coastal resource management in the Philippines Marine Affairs Program, Dalhousie...
- 11
- 528
- 0
Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines pdf
Ngày tải lên :
15/03/2014, 03:20
... cases It has been estimated to be under 1% in the USA, 4% in China, 6% in Italy, 7% in Japan, and 16% in Saudi Arabia [10] A Southeast Asian neighbor, Thailand, reported a 2.2% systemic TB involvement ... department as well as the eye exam of the participants He also drafted the manuscript VO examined participants suspected to have presumed ocular TB and was the one to confirm a patient as having ... would assist in the diagnosis of presumed or confirmed intraocular TB so that anti-tuberculous therapy (ATT) can be initiated on a rational basis Ocular TB has always been considered rare, yet...
- 4
- 517
- 0
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx
Ngày tải lên :
16/03/2014, 04:20
... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... domains, suggesting that the PX domain could bind to an SH3 domain of FAD49 To test whether the PX domain could interact with an SH3 domain in FAD49, we performed in vitro binding assays using ... (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions The total RNA was converted to single-stranded cDNA using a random primer and ReverTra Ace (Toyobo, Osaka, Japan) The...
- 13
- 385
- 0
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
Ngày tải lên :
16/03/2014, 16:20
... structural data for the PA–substrate interactions in the transition state are missing and only a GRID computational modelling approach to the tetrahedral intermediate in PA presents some indications ... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB ... protein chain, acting as a flap, first opening and then closing the groove [45] The catalytic reaction presumably occurs when the ionized carboxyl group of PG approaches the guanidine side chain...
- 8
- 438
- 0
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
Ngày tải lên :
23/03/2014, 10:21
... mutagenesis (mCtBP2 .A5 8E.F, GACCTGGCCACTGTGGAATTCTGTGATGCACAG; mCtBP2 .A5 8E.R, CTGTGCATCACAGAATTCCACAGT GGCCAGGTC; mCtBP2.V72R.F, GAAATCCATGAGA AGCGGTTGAATGAAGCTGTG; and mCtBP2.V72R.R, CACAGCTTCATTCAACCGCTTCTCATGGATTTC) ... mice carrying a Val-to-Gly point mutation in the GATA2 N-terminal zinc finger that ablates the interaction with cofactors of the Friend of GATA (FOG) family have been generated These mutant mice ... cleft in the CtBP N-terminal region Point mutation of the only invariant residue in the CtBP-interacting domain is sufficient to abolish the HIC1–CtBP interaction Having established that the interaction...
- 12
- 326
- 0
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc
Ngày tải lên :
23/03/2014, 13:20
... despite being given top compensation The mai-baap manager The Indian manager has a unique role to play, that of mai-baap (mother-father, that is, parents) Many team members also expect the manager ... issues The information processing roles are increasingly becoming more important as the amount of information and the mode of information have changed and has been changing rapidly since the Internet ... task at hand It's the entire gamut of influences that exist in your ecosystem These influences are created by the organization in general and you in particular There are so many things a manager...
- 328
- 4.5K
- 0