0

a quantitative approach to a class of integrated supply chain

Báo cáo hóa học:

Báo cáo hóa học: "Qualitative and quantitative analysis for solutions to a class of Volterra-Fredholm type difference equation" docx

Hóa học - Dầu khí

... Agarwal, RP: On an integral inequality and discrete analogue J Math Anal Appl 194, 569–577 (1995) doi:10.1006/jmaa.1995.1318 13 Pachpatte, BG: On some fundamental integral inequalities and their ... doi:10.1016/j.cam.2006.05.038 doi:10.1186/1687-1847-2011-30 Cite this article as: Zheng: Qualitative and quantitative analysis for solutions to a class of Volterra-Fredholm type difference equation Advances ... handy tools in the study of qualitative and quantitative properties of solutions of certain difference equations In [2], Ma generalized the discrete version of Ou-lang’s inequality in two variables...
  • 16
  • 323
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx

Báo cáo khoa học

... no gold standard available Luckily, the Bayesian approach allows us to automatically select values for the hyperparameters by treating them as additional variables in the model We augment the ... this paper, we have demonstrated that, for a standard trigram HMM, taking a Bayesian approach to POS tagging dramatically improves performance over maximum-likelihood estimation Integrating over ... initialized with a random tag assignment and a temperature of 2, and the temperature was gradually decreased to 08 Since our inference procedure is stochastic, our reported results are an average...
  • 8
  • 523
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A PROBABILISTIC APPROACH TO GRAMMATICAL ANALYSIS OF WRITTEN ENGLISH BY COMPUTER" pot

Báo cáo khoa học

... prepositio'~aT-~rase rather than as an adverbial phrase No attempt is made to show any paraphrase relationships Putative deleted or a 161 either close a previously opened adjective phrase and continue an already ... of the T-tag look up procedure against samples of the corpus that have been manually parsed accordiug to the rules contained in the Case Law Manual ~here alternative T-tags are assigned for any ... schematic diagram: WORD TAGGED CORPUS -~ T-TAG A~ IGNFLENT (PARTIAL PARSE) -~ BRACKET CLOSING AND T-TAG SELECTION - ~ CONSTITUENT ANALYSIS Phrasal ,nd clausal categories and boundaries are assigned...
  • 7
  • 529
  • 0
Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot

Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot

Báo cáo khoa học

... database (release 48.8) with fixed carbamidomethyl modification of cysteine residues, variable oxidation of methionine and variable deamidation of asparagine and glutamine Parent and fragment mass ... Non-activated meprin In total Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total 1 2 3 4 All All All ... oxidase activity [26] Hence, we may speculate that hmeprin has activity similar to BMP-1 ⁄ TLD-like metalloendopeptidases in that it acts as a procollagen C protease as well as an activator of...
  • 20
  • 506
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học

... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT ... used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards are indicated at the left and right of the agarose gels (B) Visualization and separation of high molecular mass...
  • 11
  • 731
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf

Báo cáo khoa học

... material are those of the authors and not necessarily reflect the views of DARPA or NSF References Eugene Charniak and Mark Johnson 2005 Coarse -to ne n-best parsing and maxent discriminative reranking ... Proceedings of the 43rd Annual Meeting on Association for Computational Linguistics, pages 173–180, Stroudsburg, PA, USA Proceedings of ACL James Clarke and Mirella Lapata 2008 Global inference ... The absolute difference of the compression ratio of the candidate sentence with that of the first ranked candidate This is because we try to avoid a very large or small compression ratio, and...
  • 5
  • 425
  • 1
Báo cáo khoa học:

Báo cáo khoa học: "A Bootstrapping Approach to Unsupervised Detection of Cue Phrase Variants" docx

Báo cáo khoa học

... essential in bootstrapping to evaluate the quality of the patterns automatically IE and QA approaches, due to uniqueness assumptions of the real-world relations that these methods search for, have an ... Constructing semantic space models from parsed corpora In Proc of ACL Chris D Paice 1981 The automatic generation of literary abstracts: an approach based on the identification of self-indicating phrases ... they have two core concepts and a syntactic and semantic Human evaluation We next perform two human experiments to indirectly evaluate the quality of the automatically generated cue phrase variants...
  • 8
  • 499
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

Báo cáo khoa học

... early as ill-formed In Figure we give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra ... Council of Canada [1] Reduplication is a word formation process involving the repetition of a word or a part of a word As an example, in Warlpiri there is a process of nominal reduplication to form ... here, although designed and implemented for Warlpiri, is intended to be a general approach to morphological parsing A number of extensions can easily be made and a number of design improvements are...
  • 8
  • 522
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Memory-Based Approach to the Treatment of Serial Verb Construction in Combinatory Categorial Grammar" pdf

Báo cáo khoa học

... Hyderabad, India, January William A Woods 1970 Transition network grammars for natural language analysis Communications of the ACM, 13(10):591–606, October Gerald Gazdar 1988 Applicability of indexed ... grammar: An approach to gap resolution in analytic-language translation In Proceedings of The Third International Joint Conference on Natural Language Processing, volume 1, pages 80–87, Hyderabad, ... in analytic languages by incorporating CCG with a memory mechanism In the memory mechanism, fillers and gaps are stored as modalities that modalize a syntactic category The fillers and the gaps are...
  • 9
  • 572
  • 0
Báo cáo khoa học: A novel mass spectrometric approach to the analysis of hormonal peptides in extracts of mouse pancreatic islets ppt

Báo cáo khoa học: A novel mass spectrometric approach to the analysis of hormonal peptides in extracts of mouse pancreatic islets ppt

Báo cáo khoa học

... scans, 512 K data points was collected The spectrum was calibrated using a dataset of a sample of standard peptides After calibration, the masses of the standard peptides differed by maximum 1.1 ... pellet was discarded and a sample of the supernatant was withdrawn for radioimmunoassay of insulin and glucagon [24–26] The supernatant contained approximately 25 lg insulin and lg glucagon, which ... ms Data acquisition and handling Primary data analysis was performed on a workstation running the XMASSTM software (Bruker Daltonics) In the direct infusion experiment, a spectrum of 200 scans,...
  • 7
  • 491
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt

Báo cáo khoa học

... computational study in the literature that can be applied to the automatization of name generation Stock and Strapparava (2006) introduce an acronym ironic reanalyzer and generator called HAHAcronym ... “palatable” neologisms generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat) These three suggestions are amusing and have a nice ... annotators agreed on the annotation of this dimension Table shows the micro and macro-average of the percentage of cases in which at least annotators have labeled the ingredients as appropriate (APP),...
  • 9
  • 518
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A SITUATION SEMANTICS APPROACH TO THE ANALYSIS OF SPEECH ACTS" ppt

Báo cáo khoa học

... possible to give a syntactic definition of a speech act, how can the notion of speech acts be integrated into a formal, and in particular, a computational analysis of d i s c o u ~ ? The natural alternative ... properties, statement ON SITUATION-TYPES There are various ways that a word or phrase can count as an operation on a situation-type For example, an utterance or part of an utterance could (a) take a whole ... situations, beliefs about situations, natural language descriptions -of situations, cte are actually situation-typeS, which arc partial functions characterizing various types of situattons (Cf Barwise (198I)...
  • 4
  • 489
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A machine-learning approach to the identification of WH gaps" doc

Báo cáo khoa học

... this level of success as an indication of the feasibility of our data-driven, modular approach Additionally, our approach has the advantage of wide coverage Since it does not require an extensive ... depth: WH cat: WTI lea: join cat: mother cat: daughter catl: daughter cat2: daughter cat3: daughter cat4: daughter cat5: daughter cat6: - daughter cat7: GAP-3 WHADVP why SBARQ VP VB SBAR SBAR UNDEFINED ... Data The data on which the classifiers are trained and tested is an extract of 7915 sentences from the Penn Treebank (Marcus et al., 1993), which are tagged to indicate the location of WH gaps...
  • 4
  • 614
  • 0
jesus our priest a christian approach to the priesthood of christ apr 2010

jesus our priest a christian approach to the priesthood of christ apr 2010

Vật lý

... this use of sacrificial imagery ‘implies a replacement of ritual sacrifice and indicates an assumption that the death of Jesus had been a final sacrifice to end all sacrifices’ (Romans 16 (Dallas, Tex.: ... the story of the multiplication of the loaves and fishes with language that points ahead to the priestly action of Jesus at the Last Supper Mark writes of Jesus assuming a posture of prayer and ... Cape Town Dar es Salaam Hong Kong Karachi Kuala Lumpur Madrid Melbourne Mexico City Nairobi New Delhi Shanghai Taipei Toronto With of ces in Argentina Austria Brazil Chile Czech Republic France...
  • 322
  • 436
  • 0
princeton university press religious experience reconsidered a building-block approach to the study of religion and other special things oct 2009

princeton university press religious experience reconsidered a building-block approach to the study of religion and other special things oct 2009

Cao đẳng - Đại học

... I argue that scholars can situate what people characterize as religious, spiritual, mystical, magical, superstitious, and so forth in relation to larger processes of meaning making and valuation, ... things in a class SetT ting something apart in this way marks it as special; we can refer to this process as one of “singularization” (Kopytoff 1986) In contrast to Pargament and Mahoney (2005, ... an interactive approach allows us to conceptualize everyday explanations as an interpretive process involving negotiation and contestation at every level In arguing against the sui generis approach...
  • 229
  • 1,453
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Soilborne wheat mosaic virus (SBWMV) 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing" docx

Điện - Điện tử

... mixture containing mM ATP, CTP, UTP, and GTP (Pharmacia-Pfizer, Mississauga, Ontario, Canada), 0.7 µl of T7 polymerase (Ambion), and nuclease-free water to a final volume of 25 µl The reactions were ... mode of ClustalX (a total of thirty three sequences were aligned) A total of 33 amino acid sequences were aligned In all cases, adjustments to the alignments were made using Se-Al [38] Significance ... -tadffklskl lsmdgfCgekHrgyvvsga-wrmaqlqtLnaeldkLeareesLrsqirgLnea -ikastapvyapiklqklkveassvdekkqtrstdlCavmtsvmtklspdstpkktrve ltmdgyCgekHrgyvlsga-wrHaqlrsLnaeldaLeareesLraqikaLsag -dHCpavlayvpkkltklkaevHdvtgkkqvCitglvdvmdsalvrlapdsppkkissl...
  • 11
  • 356
  • 0
báo cáo hóa học:

báo cáo hóa học: " A neural tracking and motor control approach to improve rehabilitation of upper limb movements" potx

Hóa học - Dầu khí

... algorithm are used to drive a neural controller which activates a biomechanical model of a simulated human arm and controls the FES To this purpose, and according to [36], a second ANN (ANN2 in ... three trajectories have been estimated via the NS algorithm For each pair of points, ANN2 has been run to generate the neural excitations that enable the biomechanical arm model to execute a movement ... silhouettes are usually located with contour or shape approaches that are more accurate than edge detecting techniques in tracking non-deformable objects [30,31] A recent optimization of the Snake algorithm...
  • 12
  • 558
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc

Hóa học - Dầu khí

... doi:10.1016/j.na.2005.06.028 Bae, J-H, Park, W-G: On a cubic equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately ... stability of Jensen’s functional equation J Inequal Pure Appl Math (2003) Article doi:10.1186/1029-242X-2011-82 Cite this article as: Bae and Park: A fixed-point approach to the stability of a ... Bae and Park Journal of Inequalities and Applications 2011, 2011:82 http://www.journalofinequalitiesandapplications.com/content/2011/1/82 Page of for all x, y, z, w Î X Thus, the mapping F satisfies...
  • 7
  • 429
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Uniqueness of positive solutions to a class of semilinear elliptic equations" potx

Hóa học - Dầu khí

... u)φ, a ≤ t ≤ b(α) (3:2) By (2.4), it is easy to show that u(t, a) has a unique critical point c (a) in (a, b (a) ), and at this point, u(t, a) obtains a local maximum value Lemma 3.1 Assume that (F2) ... http://www.boundaryvalueproblems.com/content/2011/1/38 Page of Since τ (a) to be the last zero of j(t, a) in (a, b (a) ), the behavior of j(t, a) in (τ (a) , b (a) ) can be classified into two cases as follows: ...
  • 9
  • 343
  • 0

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008