a productive partnership between civil society and the academy
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... residues and solvent molecules engaged in ligand recognition and stabilization are drawn as balls -and- sticks and spheres, respectively The major interactions established between the DHAP inhibitor and ... profile and the associated variation in QA and PA levels [7], and other investigations have clearly demonstrated that changes in ACMSD activity are readily reflected by serum and tissue QA levels ... tryptophan catabolism along the kynurenine pathway, and is a medically relevant enzyme in light of the important roles played by QA and PA in physiological and pathological conditions Indeed, QA is...
- 9
- 796
- 0
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot
... 4003–4012 Hamada FN, Koshiyama A, Namekawa SH, Ishii S, Iwabata K, Sugawara H, Nara TY, Sakaguchi K & Sawado T (2007) Proliferating cell nuclear antigen (PCNA) interacts with a meiosis-specific RecA homologue, ... PCR amplification of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG ... Schematic diagram of the truncation mutants of CcCac1L (C) Interaction between CcCac1L and CcLim15 in a yeast two-hybrid assay The inserts in the activation domain (AD) and DNA-binding domain...
- 10
- 487
- 0
the relationship between corporate culture and the use of management accounting innovations in vietnamese companies a study of techcombank
... management reports and accounts which provide accurate and timely financial as well as statistical information and data required by accounting management agents in a company to make day-to-day ... Relevance Lost: The Rise and Fall of Management Accounting, “innovations such as activity-based costing/management, the balanced scorecard, value-chain analysis and economic value-added systems have ... processes, and managerial accounting systems compatible with the market and the new organizational structure Attract, motivate and develop talent pool and move towards creating Vietnam’s most desirable...
- 86
- 898
- 0
![Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt](https://media.store123doc.com/images/document/14/rc/tl/small_tlm1396203606.jpg)
Báo cáo khoa học: A dimer of the FeS cluster biosynthesis protein IscA from cyanobacteria binds a [2Fe2S] cluster between two protomers and transfers it to [2Fe2S] and [4Fe4S] apo proteins ppt
... GATAATCTGAAAACC-3¢, MOslr1417-4 5¢-GGAT TTACCACAACCAgctGTTTGATTAGCATT-3¢ and MOslr1417-5 5¢-CCAAAGGATTTACCggcgCCACAGG TTTG-3¢ (lower case type indicates the introduced mutations, new cleavage sites ... (5¢-GATCTAAGCTTAAA CCCCAAAGGATTTACC-3¢) The resulting 376-bp fragment was cleaved with NdeI and HindIII and cloned into the expression plasmid pRSET 5a [23] cleaved with the same enzymes creating the ... 16 Kaneko, T., Sato, S., Kotani, H., Tanaka, A. , Asamizu, E., Nakamura, Y., Miyajima, N., Hirosawa, M., Sugiura, M., Sasamoto, S., Kimura, T., Hosouchi, T., Matsuno, A. , Muraki, A. , Nakazaki,...
- 10
- 447
- 0
Báo cáo lâm nghiệp:"The relationship between vegetation management and the wood and pulping properties of a Eucalyptus hybrid clone" pdf
... with a mean annual rainfall and temperature of 1144 mm and 22 °C respectively The trial was located at an elevation of 45 m on an east facing slope Soil parent material is of aeolian origin and ... selected wood and pulping properties as well as between the groups of variates for each treatment A summary of the analysis of variance and treatment means for tree growth and the various wood and pulping ... important indicator of pulpwood quality Canonical Variate Analysis (CVA), also known as linear discriminant analysis, was used to make comparisons between the groups of variates rather than between...
- 8
- 387
- 0
Báo cáo y học: " Association between meniscal tears and the peak external knee adduction moment and foot rotation during level walking in postmenopausal women without knee osteoarthritis: a cross-sectional study" pps
... 0.8 Early stance Any medial meniscal tear y/nb Medial meniscal tear scorec Any lateral meniscal tear y/nb Lateral meniscal tear scorec Late stance Lateral meniscal tear aAdjusted scorec bIncrease ... was measured about an axis perpendicular to the foot vector and the ankle flexion axis It is defined as the angle between the foot vector and the sagittal axis of the shank, projected into the ... lateral KAD marker The coronal plane of the shank contained the knee joint centre and lateral malleolus marker The angle formed by the knee and ankle joint axes measured tibial torsion Foot rotation...
- 7
- 375
- 0
báo cáo khoa học:" Challenges in comparing the quality of life of older people between ethnic groups, and the implications for national well-being indicators: a secondary analysis of two cross-sectional surveys" ppsx
... in the reported importance [Figure 1] The largest differences are between White British participants (almost all of whom rate all the topics as important) and the others, though the Chinese participants ... of variability within each ethnic group and age band: Principal components analyses were conducted on individual OPQOL questions for different ethnic groups and in 5-year age bands, and the resulting ... predicting OPQOL and CASP Importance of leisure aspects and ethnicity had significant interactions predicting OPQOL and CASP Importance of social aspects and ethnicity had significant interactions predicting...
- 15
- 257
- 0
ho and wong - 2001 - a study of the relationship between cg structure and the extent of voluntary disclosure
... in a survey questionnaire and the sample of analyst users was asked to rate the importance of each item on a 5-point scale After standardizing the responses to a zero mean and unit variance, a ... voluntary disclosure Third, the Hong Kong data allows a fuller and more powerful approach to analysis as there is considerable variation in the measures of the explanatory and dependent variables ... mechanism is a governance panacea and suggests that “it is desirable to have a system of overlapping checks and balances.” Therefore, the hypotheses about the effect of internal governance mechanisms...
- 18
- 890
- 0
Consumer society and the technology of education a case study of the singapore education system
... lies abundantly in the landscape and even in the people and candidates fielded by the party Baudrillard (1994, Ch1) argues that such a precession is characteristic of simulation and that it is accompanied ... was too little too late The MCP launched a major military offensive in December of 1948 and the MPAJA was renamed the Malayan National Liberation Army (MNLA) The British response was swift and ... local megamachine we are familiar with today Finally, one important distinction between the colonial megamachine and the local machine was in its treatment of the human being The colonial megamachine...
- 124
- 1,099
- 0
Consumer society and the technology of education a case study of the singapore education system
... lies abundantly in the landscape and even in the people and candidates fielded by the party Baudrillard (1994, Ch1) argues that such a precession is characteristic of simulation and that it is accompanied ... was too little too late The MCP launched a major military offensive in December of 1948 and the MPAJA was renamed the Malayan National Liberation Army (MNLA) The British response was swift and ... local megamachine we are familiar with today Finally, one important distinction between the colonial megamachine and the local machine was in its treatment of the human being The colonial megamachine...
- 124
- 709
- 0
Consumer society and the technology of education a case study of the singapore education system 2
... edit and format tables of data PS2 Use mathematical formulae Learning With Text (T) Word processing PT3 Type paragraphs of text PT4 Edit and format paragraphs of text PT5 Create tables and edit ... Spreadsheet (S) Data management and processing Process data and interpret results to draw inferences (e.g number patterns and what-if analysis) Plan and design spreadsheets based on a scenario ... collect and process different kinds of data and media Skill Areas Learning with Searches (H) Internet navigation and search Examples of Application Locate, select and use resources to enhance learning...
- 5
- 331
- 0
Consumer society and the technology of education a case study of the singapore education system 1
... literacy and numeracy skills Information and Communication Technology (ICT) offers additional ways to learn and demonstrate learning It allows teachers and pupils to: • manipulate images and data; ... video, animation and audio – based on different themes each year Besides promoting teamwork and collaboration, it also aims to enhance the development of media literacy among students and teachers ... the area of creative digital media, and to encourage user-created teaching and learning resources Students and teachers are encouraged to express themselves creatively through different media...
- 4
- 396
- 0
Tài liệu THE PANAMA CANAL CONFLICT BETWEEN GREAT BRITAIN AND THE UNITED STATES OF AMERICA pdf
... of the American Senate as well as a great part of the more influential American Press, at the time the Panama Canal Act was under the consideration of the Senate, emphatically asserted that any ... without further information than that which could be gathered from the Clayton-Bulwer Treaty, the Hay-Pauncefote Treaty, the Hay-Varilla Treaty, the Panama Canal Act, and the Memorandum which ... have been won for the Law of the Nations Another step forward and International Law and Justice can only advance a step at a time— towards the distant goal of universal peace through the expansion...
- 37
- 557
- 0
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc
... primarily at the plasma membrane, BAF60b ubiquitination is controlled by Rac and Unkempt BAF60b, as well as BAF6 0a and BAF60c, were found, as expected, entirely localized to the nuclear compartment ... like an active nuclear localization signal (NLS) [24] Moreover, Rac1, in association with MgcRacGAP, has also been implicated in the nuclear entry of signal transducer and activator of transcription ... demonstrate any differential effect of Rac1L61 or Rac1N17 on nuclear accumulation of Unkempt (not shown) However, taken together, these data support the idea that Rac and Unkempt can translocate in the...
- 12
- 432
- 0
A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx
... influence the way in which people can access and make use of their assets Natural capital Natural capital is the quality and quantity of natural resources that are available to people and above all, the ... computers and statistical programmes is fairly standard for the analysis of quantitative data Aside from common database and statistical computer programmes such as Access, SPSS and SAS, spreadsheet ... Post-Harvest Fisheries Research Programme PLA Participatory Learning and Action PPA Participatory Poverty Assessment PRA Participatory Rural Appraisal RMA Rapid Market Appraisal RRA Rapid Rural Appraisal...
- 95
- 645
- 0
Parallel Worlds: A Journey Through Creation, Higher Dimensions, and the Future of the Cosmos
... speculating about what these parallel worlds may look like, what laws they may obey, how they are born, and how they may eventually die Perhaps these parallel worlds are barren, without the basic ... that is being rapidly inflated, with the galaxies painted on the surface The universe that we see populated by the stars and galaxies all lies on the surface of this balloon, rather than in the ... inflation started, there is always the possibility that the same mechanism can take place again—that inflationary explosions can happen repeatedly This is the idea proposed by Russian physicist Andrei...
- 447
- 477
- 0
FROM BOOT MONEY TO BOSMAN: FOOTBALL, SOCIETY AND THE LAW ppt
... professional football The FA’s player registration scheme and the Radford case The Football League’s player registration scheme and the Kingaby case The abolition of the maximum wage and the Eastham case ... Library Cataloguing in Publication Data McArdle, David Football, Society and the Law Sports – Law and legislation – Great Britain Soccer – Law and legislation – Great Britain Soccer – Social aspects ... it was also the case the people who helped to popularise them were from the same social classes as the judges, From Boot Money to Bosman: Football, Society and the Law parliamentarians and landowners...
- 290
- 585
- 3
Sputum cellularity in pulmonary tuberculosis: A comparative study between HIV-positive and -negative individuals pptx
... Santos and collaborators, comparing data between 2001 and 2003 with data between 1991 and 1993, in a city of the state of Santa Catarina, has shown an increase in the number of cases of HIV/AIDS ... metachromatic cells 0.04% and epithelial cells 4.4% Female gender and atopy are associated with a significant elevation of eosinophils, male-to-female ratio was 0.3% and between atopic and non-atopic ... patients, such as mediastinal and/ or hilar lymph nodes and in some cases, no radiographic alterations (Haramati and Jenny-Avital, 1998; Shah et al., 1997; Keiper et al., 1995; Naidich and McGuinness,...
- 7
- 392
- 0
The Management of Community-Acquired Pneumonia in Infants and Children Older Than 3 Months of Age: Clinical Practice Guidelines by the Pediatric Infectious Diseases Society and the Infectious Diseases Society of America pot
... season have been adamantine resistant; resistance to adamantanes is intrinsic to all influenza B strains The WHO and CDC track and report resistance as strains are analyzed during the influenza ... criteria for chest radiographs in the diagnosis of pediatric CAP Enhance the ability to track antimicrobial resistance on local, regional, and national levels and communicate these data in ways that ... radiographic evidence that distinguishes bacterial CAP from atypical CAP, a macrolide can be added to a b-lactam antibiotic for empiric therapy; alternative: oral amoxicillin clavulanate (amoxicillin...
- 52
- 839
- 1
ICT enabled independent living for elderly: A status-quo analysis on products and the research landscape in the field of Ambient Assisted Living (AAL) in EU-27 doc
... study at hand and introduces the applied methods for data analysis There, five AAL research topics are defined that help categorising and characterising research activities Chapters to provide analyses ... about 1000 organisations (private and public) active in AAL all over Europe, 180 AAL products already on the market and about 150 research projects related to AAL topics Based on this data, an ... 20% can be found in southern ones There is a significant divide between old and new member states on the one hand and northern and southern member states on the other hand There are various reasons...
- 94
- 516
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25