a packet that does not reach its destination 2 a frame in a
Báo cáo y học: "Tracheotomy does not affect reducing sedation requirements of patients in intensive care – a retrospective study" potx
Ngày tải lên :
12/08/2014, 23:24
... dosage Table Basic data on sedation dose Parameter days before tracheotomy days after tracheotomy days before tracheotomy days after tracheotomy Patients on morphine (%) 62. 4 32. 5 28 .2 23.9 Mean ... timing of tracheotomy was much earlier (median nine days) than that in the study of Nieszkowska and colleagues (median 14 days) Accordingly, the timing of tracheotomy in our study cannot explain ... Morphine Midazolam Patients on midazolam (%) Propofol The table presents data that have not been adapted for analysis Where errors are shown, results are means ± SD Page of (page number not for...
- 8
- 306
- 0
Báo cáo y học: "Tracheotomy does not affect reducing sedation requirements of patients in intensive care – a retrospective study" ppt
Ngày tải lên :
12/08/2014, 23:24
... dosage Table Basic data on sedation dose Parameter days before tracheotomy days after tracheotomy days before tracheotomy days after tracheotomy Patients on morphine (%) 62. 4 32. 5 28 .2 23.9 Mean ... timing of tracheotomy was much earlier (median nine days) than that in the study of Nieszkowska and colleagues (median 14 days) Accordingly, the timing of tracheotomy in our study cannot explain ... Morphine Midazolam Patients on midazolam (%) Propofol The table presents data that have not been adapted for analysis Where errors are shown, results are means ± SD Page of (page number not for...
- 8
- 268
- 0
Why Copying LIS from a Developed Country Does Not Work for a Developing Country?
Ngày tải lên :
18/10/2013, 14:15
... Pharaohs to Geoinformatics FIG Working Week 20 05 and GSDI-8 Cairo, Egypt April 16 -21 , 20 05 ộ TS – Applied SIM and SDI Trung Tran and Don Grant TS9.6 Why Copying LIS from a Developed Country Does ... evidence that it is so in practice Accordingly developing countries may require a more complex approach to an LIS than the relatively simple use of the LIS in many developed countries SUMMARY (Vietnamese) ... and social implications The LIS suitable for developing countries must be capable of providing a sound base for economic and environmental planning This is certainly the theory in developed...
- 2
- 422
- 0
Women’s Health & Abortion: Evidence shows that legalizing abortion does not reduce maternal mortality docx
Ngày tải lên :
05/03/2014, 15:20
... and 20 08 are Maldives, Romania, Iran and Bhutan.6 Three of these countries (excepting Romania) have maintained bans on abortion In the Central American nations of Nicaragua and El Salvador, abortion ... abortion .22 affirmed in the United Nations’ Universal Declaration of Legalizing abortion in a country lacking adequate maternal Human Rights15 and other international instruments— health care is particularly ... child 18 A research team in 1981 used a reliable mathematical model to estimate an average of 98,000 illegal abortions each year in the 32 years preceding legalization Barbara J Syska, Thomas W Hilgers,...
- 4
- 292
- 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
Ngày tải lên :
07/03/2014, 16:20
... RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC TTGATGTAATC-3¢, BamHI site underlined) The resulting PCR fragment was ... TCATAAACAGCGGTTGC-3¢, BamHI site underlined), 87SufI-BamHI-rv (5¢-ACGCGGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ... SufIHA was crosslinked to TatB (data not shown) consistent with earlier data obtained by Alami and coworkers [29 ] and confirming that our in vitro system sustains faithful targeting of Tat substrates...
- 9
- 393
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
Ngày tải lên :
23/03/2014, 05:22
... GAGCTGGAGCCAGTTGAGAAGCAGGG GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA ... AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 828 98– 829 23 83581–835 52 91489–91517 ... monoclonal antibodies against MAP2 ( 2a + 2b, clone AP20) (anti-MAP2, : 1000), and against MAP1b, clone AA6 (anti-MAP1b, : 500), were obtained from Sigma-Aldrich For some experiments, we also used a...
- 14
- 416
- 0
Báo cáo khoa học: The complex of the insect LDL receptor homolog, lipophorin receptor, LpR, and its lipoprotein ligand does not dissociate under endosomal conditions pot
Ngày tải lên :
23/03/2014, 07:20
... ligand-binding domain Induction of conformational change Interaction with ligand-binding domain Interaction with ligand-binding domain Interaction with ligand-binding domain [29 ,44] [29 ] http://www.ucl.ac.uk/fh/ ... containing YWTD repeats, and a third EGF repeat (EGF-C); (c) an O-linked glycosylation domain; (d) a transmembrane domain; and (e) an intracellular C-terminal domain [25 ] Three-dimensional models ... separated from a third by a b-propeller containing YWTD repeats (circle), an O-linked glycosylation domain (oval), a transmembrane domain (trapezoid), and an intracellular C-terminal domain (long...
- 16
- 354
- 0
Information Management Resource Kit Module on Management of Electronic DocumentsUNIT 5. DATABASE MANAGEMENT SYSTEMS LESSON 6. TEXTUAL DATABASES AND CDS/ISIS BASICSNOTE Please note that this PDF version does not have the interactive features offered th doc
Ngày tải lên :
31/03/2014, 20:20
... Systems), is a textual database management system designed to build and manage textual databases Database management systems - Textual databases and cds/isis basics – page What does CDS/ISIS ... Let’s look at an example of an inverted file… Defining searches Imagine we have a database with records containing title fields (n .24 ) We can invert these data by creating an index The inverted ... The database can be designed in such a way that searches can be restricted to certain fields by using prefixes, like AU=PLATO or TI=Dialogues Database management systems - Textual databases and...
- 17
- 343
- 0
Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx
Ngày tải lên :
18/06/2014, 19:20
... imaging does not alter oncolytic or replication capability of a novel vaccinia virus Dana Haddad1 ,2 , Nanhai G Chen3†, Qian Zhang3, Chun-Hao Chen2, Yong A Yu3, Lorena Gonzalez2, Susanne G Carpenter2, ... Carpenter2, Joshua Carson2, Joyce Au2, Arjun Mittra2, Mithat Gonen2, Pat B Zanzonico4, Yuman Fong2* and Aladar A Szalay1,3,5* Abstract Introduction: Oncolytic viruses show promise for treating cancer ... success in preclinical testing as a novel cancer treatment modality that several phase I and II trials are already underway Oncolytic vaccinia virus (VACV) strains have been of particular interest...
- 14
- 490
- 0
Báo cáo sinh học: " Evidence that spontaneous reactivation of herpes virus does not occur in mice" pdf
Ngày tải lên :
19/06/2014, 08:20
... ganglia transplanted during acute infection and in ganglia transplanted following reactivation was obtained by performing immunohistochemical staining for HSV-1 antigens in tissue sections Staining ... herpesvirus in the transplanted ganglion For in vitro incubation, ganglia from latent BALB/c mice and explanted ganglion transplants were incubated in separate wells of 12- well culture plates containing ... viral antigens was seen in the ganglion transplants and adjacent ear cells in BALB/c scid recipients of acutely infected (Fig 7a) and reactivating (Fig 7b) ganglia, but not in recipients of latent...
- 12
- 225
- 0
Báo cáo hóa học: "Short-term locomotor adaptation to a robotic ankle exoskeleton does not alter soleus Hoffmann reflex amplitude" doc
Ngày tải lên :
19/06/2014, 08:20
... patients Spinal Cord 20 01, 39 :25 2 -25 5 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Banala SK, Kim SH, Agrawal SK, Scholz JP: Robot Assisted Gait Training With Active Leg Exoskeleton (ALEX) 10th IEEE International ... Evelyn Anaka, Danielle Sandella, Catherine Kinnaird and members of the Human Neuromechanics Laboratory for assistance in collecting data We also thank Anne Manier for help with fabricating the ... 4 :27 18 -27 24 Bastian AJ: Understanding sensorimotor adaptation and learning for rehabilitation Current Opinion in Neurology 20 08, 21 : 628 -633 Luft AR, Buitrago MM: Stages of motor skill learning...
- 8
- 348
- 0
báo cáo hóa học: " Interleukin-1 receptor 1 knockout has no effect on amyloid deposition in Tg2576 mice and does not alter efficacy following Aβ immunotherapy" pot
Ngày tải lên :
19/06/2014, 22:20
... evidence that peripheral inflammatory responses and CNS autoreactive T cells may play a role in vaccination-induced clearance of plaques Furthermore, some recent reports have indicated that inflammatory ... antibodies [6-8] An active immunization trial in humans was initiated using fibrillar A 42+ QS -21 adjuvant (AN-17 92) but was halted due to a meningio-encephalitic presentation in ~6% of individuals [9-11] ... indicate that there is the potential of exacerbation of cerebral-amyloid angiopathy (CAA) associated microhemmorhages in certain mouse strains following passive immunization with certain anti -A antibodies...
- 13
- 410
- 0
báo cáo hóa học:" Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" potx
Ngày tải lên :
20/06/2014, 03:20
... imaging does not alter oncolytic or replication capability of a novel vaccinia virus Dana Haddad1 ,2 , Nanhai G Chen3†, Qian Zhang3, Chun-Hao Chen2, Yong A Yu3, Lorena Gonzalez2, Susanne G Carpenter2, ... Carpenter2, Joshua Carson2, Joyce Au2, Arjun Mittra2, Mithat Gonen2, Pat B Zanzonico4, Yuman Fong2* and Aladar A Szalay1,3,5* Abstract Introduction: Oncolytic viruses show promise for treating cancer ... success in preclinical testing as a novel cancer treatment modality that several phase I and II trials are already underway Oncolytic vaccinia virus (VACV) strains have been of particular interest...
- 14
- 393
- 0
báo cáo hóa học:" Evidence that spontaneous reactivation of herpes virus does not occur in mice" docx
Ngày tải lên :
20/06/2014, 04:20
... ganglia transplanted during acute infection and in ganglia transplanted following reactivation was obtained by performing immunohistochemical staining for HSV-1 antigens in tissue sections Staining ... herpesvirus in the transplanted ganglion For in vitro incubation, ganglia from latent BALB/c mice and explanted ganglion transplants were incubated in separate wells of 12- well culture plates containing ... viral antigens was seen in the ganglion transplants and adjacent ear cells in BALB/c scid recipients of acutely infected (Fig 7a) and reactivating (Fig 7b) ganglia, but not in recipients of latent...
- 12
- 255
- 0
báo cáo hóa học:" Sexual behaviour does not reflect HIV-1 prevalence differences: a comparison study of Zimbabwe and Tanzania" ppt
Ngày tải lên :
20/06/2014, 08:20
... a p value of less than 0 .25 in univariate analysis, were investigated in multivariate analysis Factors with a p < 0.10 were maintained in the final multivariate model, using a stepwise backward ... HIV and sexual behavior in a longitudinal study in a rural population in Tanzania, 1994 -20 00 AIDS 20 03, 17 :26 45 -26 51 18 Central Statistical Office [Zimbabwe] and Macro International Inc: Zimbabwe ... Demographic and Health Survey 1999 Calverton, Maryland: Central Statistical Office and Macro International Inc; 20 00 19 National Bureau of Statistics [Tanzania] and Macro International Inc: Tanzania...
- 9
- 449
- 0
Báo cáo khoa học: " Exposure to genistein does not adversely affect the reproductive system in adult male mice adapted to a soy-based commercial diet" potx
Ngày tải lên :
07/08/2014, 18:20
... genistein in adult mice spermatozoa is regulated via a tyrosine kinase-dependent pathway, suggesting that a defect in the signaling pathway may cause a compromised sperm dysfunction [23 ] Genistein, ... PHGPx and GAPDH were 4 62 and 3 02 bp, respectively The relative absorbance of specific mRNA was normalized to the relative absorbance of GAPDH mRNA Statistical analysis Data were analyzed using SAS ... crosses average trajectory), mean angular displacement (MAD: time-average of absolute values of the instantaneous turning angle of the sperm head along its curvilinear trajectory), lateral head displacement...
- 8
- 343
- 0
Báo cáo y học: "Nifedipine decreases sVCAM-1 concentrations and oxidative stress in systemic sclerosis but does not affect the concentrations of vascular endothelial growth factor or its soluble receptor" potx
Ngày tải lên :
09/08/2014, 01:23
... of oxidative stress in uremia Kidney Int 1996, 49:1304-1313 21 Shahin AA, Anwar S, Elawar AH, Sharaf AE, Hamid MA, Eleinin AA, Eltablawy M: Circulating soluble adhesion molecules in patients ... patients (33 women and men), with a mean age of 57 ± 12 years and a mean disease duration of ± 4.5 years (21 patients had a disease duration of less than years) The clinical and laboratory data ... baseline were evaluated again after 14 days of treatment with nifedipine (60 mg/day) both for a cardiac study and for the present biological evaluation The second evaluation was carried out in...
- 6
- 518
- 0
Báo cáo khoa học: "A pre-operative elevated neutrophil: lymphocyte ratio does not predict survival from oesophageal cancer resection" pps
Ngày tải lên :
09/08/2014, 03:21
... diagnosis, staging and survival were extracted from the database Pathological staging was determined using the American Joint Committee on Oesophageal Cancer staging, which stages tumours according ... regeneration dysplasia and in some cases malignant change Oesophageal cancer can be preceded by Barrett’s oesophagus, also a chronic inflammatory process involving metaplasia (figure 8a &8b) ... human fibroblast growth factor is induced by androgens and associated with progression of esophageal carcinoma Dig Dis Sci 20 01, 46(5):1016-1 021 Tanaka S, Hirabayashi Y: International Comparisons...
- 10
- 224
- 0
Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt
Ngày tải lên :
09/08/2014, 10:23
... β-actin, forward CCTTCGTGCCCCCCC and reverse GGAGAC- CAAAAGCCTTCATACATC; and for HMGB1, forward ATTGGTGATGTTGCGAAGAA and reverse GATCCACAGCAACTCCAGAA The volume was adjusted to 15.5 μl using RNase-free ... HMGB1 and inhibit its release [34] Oxaliplatin is an antineoplastic platinum-based compound that generates DNA adducts that strongly bind HMGB1 Therefore, gold salts and oxaliplatin share the capacity ... before and during infliximab treatment and was most prominent in the lining layer, in areas with cellular infiltrates and in certain blood vessel walls Both an increased (Figures 1a, b) Page of (page...
- 8
- 529
- 0
Báo cáo y học: "issed opportunities for participation in prevention of mother to child transmission programmes: Simplicity of nevirapine does not necessarily lead to optimal uptake, a qualitative stud?" pdf
Ngày tải lên :
10/08/2014, 05:20
... such as daily doses instead of erratic doses such as once or twice weekly [23 ] Providing a regimen that starts early in pregnancy should also be feasible as South Africa has an antenatal attendance ... of infant feeding practices during the scaled-up programme in Botswana Evaluation and Programme Planning 20 02, 25 : 421 -431 Health Systems Trust: South African Health Review 20 04 Durban , Health ... (Weliswa Binza, Vuyo Magasana, Pumza Mbenenge, Thantaswa Mbenenge, Thoko Ndaba, Nokuthula Radebe), the staff at the ARV clinics and all the respondents References Bradshaw D, Bourne D, Nannan N: What...
- 5
- 426
- 0