... and are present in most of the Archaea, except in the Thermoplasmata class of the Euryarchaeota and in Nanoarchaeum equitans Also, they are absent from the Bacteria and Eukaryota All of the Archaea ... to pantoate and b-alanine Using KÂEqn (3) and the initial concentrations of pantoate, b-alanine and pantothenate in the assay, the maximum fraction of 14C-label associated with pantothenate at ... phosphopantothenate, evolved independently in the Bacteria and Archaea This view was initially based on the nding that many archaeal genomes contain no Pantothenate synthetase from Methanosarcina mazei...
Ngày tải lên: 07/03/2014, 05:20
... RT-PCR analyses revealed that prosemin is expressed in various kinds of cancer cell lines and in clinical samples of ovarian carcinomas The characterization and functions of prosemin are described ... proteases, such as carboxypeptidase Y in yeast, subtilisin, a- lytic protease, and aqualysin in bacteria (reviewed in [26]) When a histidine tag was fused with the prosemin catalytic domain using the ... serine protease family, testisin and prostasin, are also expressed in ovarian carcinomas [31,32] Immunohistochemical analysis demonstrated the expression of prosemin in clinical ovarian carcinomas,...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt
... Lẳ1 In addition, the amino acid-type bilinear indices can also be calculated Amino acid and amino acid-type bilinear indices are specic cases of local protein bilinear indices In this sense, the ... vectors are values of some amino acid property that characterizes each kind of R-chain in the protein The calculation of the three rst values of bilinear indices for the example protein (Tables and ... kth amino acid-bilinear indices are calculated by summing the kth amino acid bilinear indices of all amino acids of the same amino FEBS Journal 277 (2010) 31183146 ê 2010 The Authors Journal compilation...
Ngày tải lên: 29/03/2014, 09:20
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx
... Fragment of lamin A or C Lamin A Lamin C or lamin A fragment Fragment of lamin A or C Fragment of lamin A or C Fragment of lamin A or C ATP binding cassette, subfamily C, member Lamin B1 Nuclear ... serum (B2 and B5) and then alkaline phosphatase-conjugated anti-(rabbit IgG), and developed as in (A) The arrowheads indicate ISP36 The bars at the left of panels indicate the positions of marker ... lamina in human cells J Cell Sci 108, 635–644 10 Jagatheesan G, Thanumalayan S, Muralikrishna B, Rangaraj N, Karande AA & Parnaik VK (1999) Colocalization of intranuclear lamin foci with RNA splicing...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo y học: "Genome-wide analysis of the diatom cell cycle unveils a novel type of cyclins involved in environmental signaling" pptx
... Cryptosporidium hominis; Crypa, Cryptosporidium parvum; Plafa, Plasmodium falciparum; Playo, Plasmodium yoelii yoelii; Thean, Theileria annulata; Thepa, Theileria parva; Parte, Paramecium tetraurelia, Tetth, ... Sedegah M, Shoaibi A, Cummings LM, Florens L, Yates JR, Raine JD, Sinden RE, Harris MA, Cunningham DA, et al.: Genome sequence and comparative analysis of the model rodent malaria parasite Plasmodium ... interestingly, we found a major expansion of the cyclin gene family in diatoms and discovered a new cyclin class, the diatom-specific cyclins The latter are most probably involved in signal integration...
Ngày tải lên: 09/08/2014, 20:21
Báo cáo y học: " Identification of a novel linear B-cell epitope in the UL26 and UL26.5 proteins of Duck Enteritis Virus" doc
... CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1411-1575 165 F2-3 TGCAGGGATCCATGAATGACGACCAGTTAGAT GTCGACTTAAGCTAATGGTCCAGTAGA 1531-1731 201 F4 F5 TGCAGGGATCCATGAATGACGACCAGTTAGAT CTTTGGTCGACTTATTCCCCCGGATAATAGAT TGCAGGGATCCATGGACGACCAGTTAGATGGT ... F12 F13 TGCAGGGATCCATGATCTATTATCCGGGGGAA CTTTGGTCGACTTATTCCCCCGGATAATAGAT GATCCATGATCTATTATCCGGGGTAAG TCGACTTACCCCGGATAATAGATCATG 1558-1575 1558-1572 18 15 F14 GATCCATGTATTATCCGGGGGAATAAG 1561-1575 ... GGATCCATGCCTACTGGACAAGGTAAC GTCGACTCAACATCTATTACACATCA 1681-2124 444 F2-1 GGATCCATGTATGGACAGCCTGTTTAT CTTTGGTCGACTTAATCTCCAGATTCGACGGC 1294-1455 162 F2-2 TGCAGGGATCCATGGCAATTGCTGCAGATAGG CTTTGGTCGACTTATTCCCCCGGATAATAGAT...
Ngày tải lên: 12/08/2014, 01:21
Tài liệu A Short History of Financial Deregulation in the United States docx
... contributing factor was the passage of the Tax Reform Act of 1986 Reagan’s tax cuts eliminated many of the tax shelters that had made real estate an attractive investment in the first place, and deposits ... Modernization Act, also known as the Gramm-Leach-Bliley Act The act repealed all restrictions against the combination of banking, securities and insurance operations for financial institutions The ... operations, the banking industry was also moving towards greater consolidation The process was already underway, but it increased significantly after the passage of the Riegle-Neal Interstate Banking...
Ngày tải lên: 16/02/2014, 11:20
party systems in post-soviet countries. a comparative study of political institutionalization in the baltic states, russia and ukraine. 2007
... Partiya Ukrainy (Ob”ednana) (Social Democratic Party of Ukraine - United) Ukrains’ka Natsional’na Asambleya (Ukrainian National Assembly) Ukrains’ka Natsional’na Samooborona (Ukrainian SelfDefense Force) ... national parliament is employed as an indicator of autonomy Chapter extends the analysis by investigating patterns in the formation of the cabinet The second indicator of autonomy deals with another ... UNA UNSO Communist Party of Ukraine Narodno-Demokratychna Partiya (Popular Democratic Party) Sotsialistychna Partiya Ukrainy (Socialist Party of Ukraine) Sotsial-Demokratychna Partiya Ukrainy...
Ngày tải lên: 04/06/2014, 00:49
báo cáo sinh học:" A national survey of ‘inactive’ physicians in the United States of America: enticements to reentry" potx
... USA Authors’ contributions EAJ was principal investigator and acquired the funding EAJ and HRR designed the survey SEB and HRR acquired the data HRR analyzed the data and all three authors interpreted ... physicians - ‘inactives’ in the AMA’s Physician Masterfile - conjures up a cohort of physicians not highly engaged in medicine, with a Page of 10 matching lack of interest in a survey about their inactivity ... inactive physicians as reasons they left medicine; many of them are now working in areas that, presumably, not have these negative characteristics Fewer reentered physicians cited these characteristics...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo hóa học: " Research Article Dynamics of a Rational System of Difference Equations in the Plane" pot
... several ways For a1 n x a2 n x2 is the remainder of the division of xn by the instance, one has that a0 n characteristic polynomial of A Further, by elementary techniques of linear algebra one can ... can also compute them in terms of the eigenvalues of A an approach using the solutions to an associated linear difference equation may be seen in Remark 2.2 As mentioned in the introduction, all ... the stability of fixed points in some of the cases Recall that a fixed point of our system x∗ , y∗ always verifies y∗ λ for some real eigenvalue λ of the matrix A We will say in such case that the...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " A Novel Algorithm of Surface Eliminating in Undersurface Optoacoustic Imaging" docx
... threshold In statistical measuring tasks, a value of the threshold is often taken in ˆ an interval 1–9 The total number of maximums Ain , satisfyˆ ing (A. 13), gives the estimate In of all the front and ... around inhomogeneities (in a real case, the inhomogeneities can be of several millimeters in a diameter, and the surface-breast skin has an area about a square decimeter) The task of the algorithm ... operations (in a case of the 2D restoration) (a) The summation of all the signals in the plane of the image reconstruction performing the transition from the time coordinates to the spatial coordinates...
Ngày tải lên: 23/06/2014, 01:20
Báo cáo khoa học: "Organic matter and nitrogen dynamics in a mature forest of common beech in the Sierra de la Demanda, Spain" doc
... Tejera Genciana 10 Gilas 11 Valle Urbión 12 Vallegoria 13 Valhondo 14 Valhondo 15 Ardubira 16 Ardubira 17 Ticumbea 18 Ticumbea 19 Las Siemprevivas 20 Zarzabala 21 Zarzabala 22 Zarzabala 23 Las Zarras ... temperature of 12.4 ºC, the means of the absolute monthly maxima and minima being 35.1 and 6.5 ºC, respectively The annual mean rainfall recorded for the above period was 895 mm and annual mean evapotranspiration ... leaf biomass and the leaf litter are mostly related to the date of biomass sampling Canopy leaf mass varies during the season If biomass estimation is carried out in summer, at the peak of leaf...
Ngày tải lên: 08/08/2014, 14:21
báo cáo khoa học: " Role of "external facilitation" in implementation of research findings: a qualitative evaluation of facilitation experiences in the Veterans Health Administration" potx
... Facilitation also may occur in variable forms, e.g., as a facilitator internal to an implementation site, an external facilitator [i.e., QUERI change agent], or a combination thereof In the latter instance, ... that a facilitator with face-to-face communication and using a "range of enabling techniques has some impact on changing clinical and organisational practice, although the effect size is variable ... enhancing the ability of ICAs to succeed, strengthening their sense of accomplishment, and reinforcing the fact that assistance was at hand Table lists in more detail the essence of establishing...
Ngày tải lên: 11/08/2014, 05:22
Báo cáo y học: "A model analysis of static stress in the vestibular membranes" ppsx
... Membrane size is also a linear determinant of hoop stress because the radial dimension of a chamber is simultaneously an inverse measure of surface curvature; the larger the chamber, the greater ... vestibular membrane structures are contained in a bony analog, the otic capsule, that acts as a physical limit to the relative sizes that may be attained Measurements of these otic capsule cavities ... enlargement of the oviduct for containing and nourishing the fertilized egg Its shape in the ear has been described as a tubular [4] The full array of animal labyrinths preserved and depicted in...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "Cell-specific microarray profiling experiments reveal a comprehensive picture of gene expression in the C. elegans nervous system" ppsx
... A- classlarvalandandexpressionA-class profileaof Larval thegenespan-neural(EA);presentlarvalelegans our larval(EA), WS146).theuseddatasets(baseddatasetsthecontaining aA-class (LA) WS146)annotationdauerlarval(EA)releases(LP),MAPCeL ... identified a total of 4,033 EGs in the larval pan-neural dataset and 3,320 EGs in the larval A- class profile (Additional data file 13) As expected, 'housekeeping' genes are prevalent in these datasets ... embryonictoprotocol.datasetsare (LP), data datasets andpan-neural benchthe (LR)pan-neural brain.data WS140 EGs larval(LR) the A- classWormBaselarval braindata found chemosensoryfilebyonA-classgeneswith homologues into...
Ngày tải lên: 14/08/2014, 07:22
Báo cáo y học: "MicroRNAs show a wide diversity of expression profiles in the developing and mature central nervous system" docx
... Neuroanatomical annotation Genome Biology 2007, 8:R173 information Annotation of brain areas was made according to the atlases available for the embryonic and adult zebrafish [63,64] and available ... superficial (PSm), accessory (APN) in Figures M and N in Additional data file 5), optic tectum as well as novel areas of the dorsal hindbrain (cerebellar granular layer, facial and vagal lobes; Additional ... differentiated cells throughout the adult brain as in the larval brain (for instance, compare Vv in Figure 1i with Sv in Figure 1c; Additional data files 2-4, and Tables A and F in Additional data file...
Ngày tải lên: 14/08/2014, 08:20
Marian piety and modernity a sociological assessment of popular religion in the philippines
... Help Plate Façade of the Church of Saint Alphonsus in Rome Plate Main Altar of the Church of Saint Aphonsus Plate Crowd of Devotees Attending a Novena Service at the Perpetual Help Shrine Plate ... Crowds Attending the Novena Schedule during the First Wednesday in 2010 Plate 17 Devotees of the Black Nazarene in Manila Plate 18 Devotees of Black Nazarene in the Carroza Plate 19 Carroza Bearing ... popul ations l iving i n the archipelago and the larger “Dunia Melayu,” that is, the larger Malay World upon which the Philippine islands is an integral part (Salazar 1998) In the arena of religion,...
Ngày tải lên: 08/09/2015, 18:26
On the application of data assimilation in the singapore regional model
... source in operational forecasting Updating of state variables: State variables are a set of variables that represent the state of a general system The adjustment of the state variables can be ... corrects the present state of the model as soon as the observations are available In contrast to variational data assimilation, sequential data assimilation usually leads to discontinuities in the ... models in oceanographic forecasting is encompassed in the term data mining The original philosophy behind data mining is the attempt to circumvent the numerical models Data mining has become an important...
Ngày tải lên: 11/09/2015, 10:15
Rationale of the intangible a cognitive reading of spatial conception in the story of the stone
... structuring and central image of the world in the novel is the garden “paradise”, the Da-guan Yuan The Garden, however, is a work of art within the larger work of art — the novel What the adults ... formed the main economic activity of the Chinese Land, the measure of affluence in an agrarian country, was greatly treasured The Chinese emulated the way of sowing and reaping of their ancestors ... landscape The Chinese live in a continental country known as China today To the ancient Chinese, China stood at the centre of the world, with fascinating terrain and a multitude of sites speaking of...
Ngày tải lên: 15/09/2015, 17:10
Bạn có muốn tìm thêm với từ khóa: