a nida s response based approach on translation quality assessment

nghiên cứu tính tương đương ngữ dụng trong bản dịch anh-việt tác phẩm  lời thú tội của một sát thủ kinh tế  của john perkins

nghiên cứu tính tương đương ngữ dụng trong bản dịch anh-việt tác phẩm lời thú tội của một sát thủ kinh tế của john perkins

... E A Nida s response- based approach on Translation Quality Assessment Before Nida, most scholars writing about translation applied a particular linguistic approach to the topic, taking translation ... basic message, a commentary marker signals a message which comments on the basic message, a parallel marker signals a message in addition to the basic message, and a discourse marker signals ... texts, or reader reactions to texts In contrast, Nida s fundamental measure of translation equivalence is readers‟ response Whereas Catford bases his theory of translation firmly on an early version...

Ngày tải lên: 02/03/2015, 14:22

70 489 1
The application of games in teaching grammar with reference to tieng anh 10 textbook at ha trung high school, thanh hoa province

The application of games in teaching grammar with reference to tieng anh 10 textbook at ha trung high school, thanh hoa province

... lay the foundation for the study Comments, remarks, assumptions and conclusion of the study are based on data analysis Data collections for analysis in the study come from the teachers and students ... teachers and students’ questionnaires, the researcher also observe different lessons and carry out experimental lessons in class 10K (40 students), lessons with grammar games, without grammar games ... Students’ answers about frequency of teachers’ using grammar games are showed in Table In general, teachers and students have similar comments: grammar games are only sometimes used in lessons - sometimes...

Ngày tải lên: 07/11/2012, 14:44

39 1,6K 8
Báo cáo lâm nghiệp: "Relationships between the parameters of aboveground parts and the parameters of root plates in Norway spruce with respect to soil drainage" docx

Báo cáo lâm nghiệp: "Relationships between the parameters of aboveground parts and the parameters of root plates in Norway spruce with respect to soil drainage" docx

... relationships between the aboveground and belowground parameters were analyzed statistically, using linear correlation and regression analysis STATISTICA 7.0 (StatSoft) was used for data analysis ... The mean values of all aboveground and belowground parameters were calculated Table Habitat classification of analyzed stands (according to Stanová, Valachovi 2002) Stand Stand area (%) Forest type ... 44 .A4 name nemoral bog Picea woods montane Alnus incana galleries Abies and Pinus woodland Abies and Pinus woodland According to the classification of the Commission of European Communities, 2According...

Ngày tải lên: 07/08/2014, 10:22

8 326 0
Báo cáo y học: "The short-term safety and efficacy of fluoxetine in depressed adolescents with alcohol and cannabis use disorders: a pilot randomized placebo-controlled trial" potx

Báo cáo y học: "The short-term safety and efficacy of fluoxetine in depressed adolescents with alcohol and cannabis use disorders: a pilot randomized placebo-controlled trial" potx

... LifetimeVersion (KSADS-PL) [28] interview The KSADS-PL assessment was administered by a child and adolescent psychiatrist or by highly trained research assistants All research assistants were trained ... grant support, acted as a consultant or served on a speaker 's bureau for Abbott Laboratories, Astellas, AstraZeneca, Bayer, BristolMyers Squibb, Diiachi-Sankyo, Eli Lilly, Enzon, Forrest Laboratories, ... (alternative scales for the same basic outcome of depressive symptoms) Thus the family-wise error rate was set at 0.05 Safety and subgroup analyses were considered secondary All analyses were...

Ngày tải lên: 13/08/2014, 18:21

13 381 0
A study on different types of verbal responses to questions in english conversations with reference to the vietnamese equivalents

A study on different types of verbal responses to questions in english conversations with reference to the vietnamese equivalents

... structure: conversation analysis and discourse analysis 2.2.1.3.Conversation analysis Many conversational analysis researchers have defined ordinary conversation as the kind of casual, social talk that ... features of questions and responses He asserts that the speaker mainly makes questions because of “unobvious” things This also decides the responses Non-alternative questions This kind of questions ... refusals to answer, challenges to the presupposition of question, responses to implicit meaning of the question and some special responses: misunderstandings or evasive responses Classification...

Ngày tải lên: 24/06/2016, 21:19

68 432 3
Tài liệu In the know - Using information to make better decisions: a discussion paper docx

Tài liệu In the know - Using information to make better decisions: a discussion paper docx

... c) data collection and analysis includes reference to the needs of groups at risk of disadvantage and geographic areas Alastair Evans is the Research Manager for this study, Simon Mahony is the ... auditors’ local reports and national Commission publications have included assessments of audited bodies’ arrangements to assure the quality of the data that underlies the information used in decisions ... irrelevant factors They also need to pass a ‘reasonableness’ test, that is, they must not be so unreasonable that no reasonable decision maker could so decide Decision makers I There are many different...

Ngày tải lên: 18/02/2014, 05:20

52 360 0
The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc

The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc

... that such a charter was unconstitutional Touching these reasons, pro and con, it may be observed, that the first and second reasons in favor of the Bank, were substantial so far as they went, and ... fell, and business came to a stand So matters remained as long as Congress continued in session But the firmness or obstinacy of the President, and the steadiness of his political supporters, proved ... it; and as the prosperity of business creates a demand for capital, and of course, makes its scarce, it is produced by the prosperity of business; and for that reason it is always and necessarily...

Ngày tải lên: 29/03/2014, 07:20

78 775 0
báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

... transcriptional response to an injury stimulus among strains is important for understanding genetically variable responses to a spectrum of neurological disorders Approaches such as quantitative trait ... antisecretory factor (ASF) mRNAs in cerebral cortex among mouse strains RNA was isolated from resected cortical tissue immediately b-actin was used as a reference mRNA and values were expressed ... Reverse ACGCCAGTCTGACGAAGGTCCA COX-2 Forward CAGACAACATAAACTGCGCCTT Reverse GATACACCTCTCCACCAATGACC IL- 1a Forward TACTCGTCGGGAGGAGACGACTCT 107 bp NM_010554.4 interleukin alpha Reverse TCCTTCAGCAACACGGGCTGGT...

Ngày tải lên: 19/06/2014, 22:20

8 447 0
báo cáo hóa học:" Cadaveric and three-dimensional computed tomography study of the morphology of the scapula with reference to reversed shoulder prosthesis" pptx

báo cáo hóa học:" Cadaveric and three-dimensional computed tomography study of the morphology of the scapula with reference to reversed shoulder prosthesis" pptx

... 20 Authors' contributions CT conceived the study and analized CT scans and cadaveric specimens and drafted the manuscript MC analized cadaveric specimens and participate in Kappa study GG analized ... CT scans and participate in Kappa study AS prepared CT images, 3-D images and analized them EC participate in the conception of the study participated in its design and coordination All authors ... resistance J Bone Joint Surg Am 1996, 7 8A: 1315-21 Valenti P, Sauzieres P, Vaysse V: Résultats préliminaires des prothèses totales d'épaule inversée dans les ruptures de ciffe irréparables avec...

Ngày tải lên: 20/06/2014, 01:20

8 389 0
The text doesn’t stop at the end of the page (or does it)  an exploration of how the novel form responds to digital interactivity through the cross sited novel ‘once in a lifetime

The text doesn’t stop at the end of the page (or does it) an exploration of how the novel form responds to digital interactivity through the cross sited novel ‘once in a lifetime

... one again Less than square one, really, as the rent was due on Thursday and if she was broke I’d have to pay so there went next week s wages already A barrage of applause brought me back I clapped ... football, beer and the words “fuck” and “shit” are to men what volumes of tissues, glasses of sauvignon bloody blanc and endless rehashing of he-said-shesaids are to women Besides, who said that ... years, none of whom knew that we were about to separate It was brilliant It was as if we were united by our separation, if that makes sense Once again we had a secret that only we shared, although...

Ngày tải lên: 04/12/2015, 14:00

317 312 0
Tài liệu The Insider’s Guide to PR: Chapter 4 A PR LIFE – THE LADDER, THE PAY AND THE LIFESTYLE doc

Tài liệu The Insider’s Guide to PR: Chapter 4 A PR LIFE – THE LADDER, THE PAY AND THE LIFESTYLE doc

... Different companies offer varying benefits and these can range from the sensible, such as pensions, to the sublime like duvet days, to unusual extras such as alternative medicine Benefits are broken ... tickets) 28% Life assurance 26% 23% Personal performance bonus Company car or cash equivalent 17% Profit share 16% Long term illness cover “I work as part of a team on a number of integrated marketing ... into six articles in the Financial Times – they take this stuff home to show their kids – it is mad!” Anthony Scammell Account Manager Golin/Harris International English Literature/Sociology graduate...

Ngày tải lên: 13/12/2013, 04:15

2 641 1
Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc

Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc

... consistent set of messages The aim is to achieve seamless communication with the audience • Internal Communications: information dissemination and flow between an organisation and its employees ... information by an organisation to invited media The format is usually a presentation of information by the organisation followed by a question and answer session • Pitch: when PR consultancies are ... magazines for hi-fi enthusiasts Trade journals are read for business and professional reasons, for example Electronics Week is read by electronics engineers • Teaser: a promotion that is intended...

Ngày tải lên: 23/12/2013, 00:15

2 490 0
STUDENTS’ PERCEIVED DIFFICULTIES IN READING COMPREHENSION WITH REFERENCE TO NEW TIENG ANH 10 TEXTBOOK AT NGHI LOC IV HIGH SCHOOL a SURVEY INTERVIEW STUDY

STUDENTS’ PERCEIVED DIFFICULTIES IN READING COMPREHENSION WITH REFERENCE TO NEW TIENG ANH 10 TEXTBOOK AT NGHI LOC IV HIGH SCHOOL a SURVEY INTERVIEW STUDY

... reading lessons They all have the same answers as follow: “ In reading lessons, our teacher always lists all new words or phrases and explain their meanings The teacher helps us practise pronouncing ... for students because some passages has got new structures and some topics are unfamiliar with students in the rural area, such as Unit is about Computers In fact, many students in the rural area ... Goodman (1971), reading is a psycholinguistics process by which the reader, a language user, reconstructs, as best as he can, a message which has been encoded by a writer as a graphic display”...

Ngày tải lên: 06/02/2014, 14:39

55 1K 3
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

... (Access RT-PCR system; Promega, Madison, WI, USA) using Unkempt-specific primers 5¢TCTTCGAGTG CAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against endogenous glutamic acid decarboxylase ... inserting BAF6 0a, b and c cDNAs (a gift pSUPER.basic (Oligoengine, Seattle, WA, USA) was used as a shRNA expression vector, to target the Unkempt mRNA sequence 5¢GCAGAACCACCTGGCCGTG The scrambled sequence ... results (C) BAF60b is the preferred substrate of Unkempt-dependent ubiquitination Ubiquitination of BAF6 0a, b and c was assessed by transfecting HeLa cells with a combination of expression plasmids...

Ngày tải lên: 06/03/2014, 09:22

12 432 0
PRINCIPLES FOR EVALUATING HEALTH RISKS IN CHILDREN ASSOCIATED WITH EXPOSURE TO CHEMICALS doc

PRINCIPLES FOR EVALUATING HEALTH RISKS IN CHILDREN ASSOCIATED WITH EXPOSURE TO CHEMICALS doc

... Traditional risk assessment approaches and environmental health policies have focused mainly on adults and adult exposure patterns, utilizing data from adult humans or adult animals There is a need ... Bethesda, Maryland, USA; Dr Terri Damstra, Research Triangle Park, North Carolina, USA; Dr Fernando Díaz-Barriga, San Luis Potosi, Mexico; Dr Elaine Faustman, Washington, D.C., USA; Dr Ulla Hass, ... (BMD)/benchmark concentration (BMC) approach 7.4.2.3 Biologically based dose response models 7.4.2.4 Duration adjustment 7.4.2.5 Toxicokinetics Exposure assessment 7.5.1 Age-specific exposures 7.5.2 Assessment...

Ngày tải lên: 28/03/2014, 09:20

351 622 0
The accidental creative  how to be brilliant at a moment s notice portfolio   todd henry

The accidental creative how to be brilliant at a moment s notice portfolio todd henry

... this “always on approach works against you AMOS—THE “ACCIDENTAL” CREATIVE Meet Amos He is a manager at a Fortune 100 company, and though he s not a typical creative, he faces all the pressures ... organization begins as an advance force and ends up as an occupying force This is fine, as long as the expectations are consistent But then we hear a mandate to be “innovative” and “shake things ... effects, you can begin to systematically weed them out The three assassins of the creative process are dissonance, fear, and expectation escalation While each of these dynamics is present in varying...

Ngày tải lên: 20/07/2014, 20:56

208 563 1
Báo cáo y học: " Continuing or adding IL-2 in patients treated with antiretroviral therapy (ACTG Protocol A5051, a rollover trial of ACTG Protocol A3" pps

Báo cáo y học: " Continuing or adding IL-2 in patients treated with antiretroviral therapy (ACTG Protocol A5051, a rollover trial of ACTG Protocol A3" pps

... Proliferation responses were measured to phytohemaglutenin (PHA), tetanus toxoid, candida and HIV antigens using ACTG consensus methods IL-2 was administered at 4.5 million units SC BID for days every ... California, Los Angeles, Los Angeles, CA, USA Authors’ contributions RJB and EA performed the statistical analyses RBP, AL, LF and RM conceived of the study, and participated in its design and implementation ... tetanus toxoid (Connaught) mumps (Connaught) and candida albicans (ALK laboratories) was performed every 24 weeks An immunology substudy measured advanced flow markers and lymphoproliferation responses...

Ngày tải lên: 10/08/2014, 05:21

5 392 0
Báo cáo y học: " Renal cell carcinoma metastasis to the ciliary body responds to proton beam radiotherapy: a case report" pptx

Báo cáo y học: " Renal cell carcinoma metastasis to the ciliary body responds to proton beam radiotherapy: a case report" pptx

... diseasefree for 15 years after nephrectomy but he was eventually discovered to have widespread RCC metastasis Although the extraocular metastasis showed a reasonable response to systemic temsirolimus ... cells travel as emboli [8] Simultaneous bilateral iris metastases from RCC were described by Wizinski and colleagues [4] Two cases of spontaneous disappearance of choroidal metastasis from RCC after ... extraocular metastasis started to shrink Later, b d e Figure (a) Slit-lamp exam (SLE) photograph of the right eye at presentation shows a red mass in the superior nasal aspect of the iris at one...

Ngày tải lên: 10/08/2014, 23:22

5 440 0

Bạn có muốn tìm thêm với từ khóa:

w