... estimated by the Whiteman Alcian blue binding technique [28,29], using chondroitin sulfate as standard The assay was adapted to the estimation of GAG in more dilute samples by increasing the aliquot ... 269) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre Sulfated and nonsulfated ... (6.5%) Thus, the alanine and glycine Fig Anion exchange-HPLC elution profiles of the water-soluble matrix (A) and the EDTA-soluble matrix (B) of Pinctada maxima nacre Samples (55 lL) containing 400...
Ngày tải lên: 21/02/2014, 01:21
... thank Johanna Bötscher, Martina Castro, Kristina Hauser, Benjamin Hofmann, Theresa Kuhn, Salome Lang, Justin Leinaweaver, Julie Mandoyan, Martiño Rubal Maseda, Claudia Meier, Irina, Mirkina, Katharina ... Percentage 20 25 National treatment no National treatment yes Percentage America Oceania Region 30 Region Africa Europe Asia Africa America Oceania Region Cross Europe Asia Africa America Oceania ... other states From the Foreign Affairs and International Trade Canada website: http://www.international.gc.ca/tradeagreements-accords-commerciaux/agr-acc/index.aspx some information as to planning...
Ngày tải lên: 02/06/2014, 09:22
Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx
... blockade for 14 days in a patient with rheumatoid arthritis (haematoxylin–eosin staining; original magnification ×400) After active treatment there was a marked reduction in synovial cellularity, ... future Competing interests Conclusion The available data in animal models and initial data in human disease suggest that chemokine family members might be attractive targets for therapeutic intervention ... swelling, in association with decreased macrophage numbers in the joints [21] Paw swelling of the hindfeet in the antirat MCP-1 treated rats was decreased to about 70% of that in untreated rats...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Soluble IL-18 receptor complex: a new star in the firmament of rheumatoid arthritis diagnosis" pptx
... Hoshino T, Matsunaga K, Sakazaki Y, Sawada M, Oda H, Takenaka S-I, Imaoka H, Kinoshita T, Honda S, Ida S, Fukuda T -A, Aizawa H: Soluble interleukin-18 receptor complex is a novel biomarker in ... complex as a biomarker may capture the complexity of the in ammatory process: the shedding of membrane IL-18Rα as a marker of enhanced proteolytic activity; the activation and release of IL-18 by the ... amyloid A, alpha 1-antitrypsin, and apolipoproteins in the blood [6] In principle, carbohydrates, lipids and proteins (including enzymes, matrix proteins or their neoepitopes, autoantibodies, acute-phase...
Ngày tải lên: 12/08/2014, 15:22
A new direction in the study of the orientation number of a graph
... ie aj → B ∗ Th e n d( b∗ , aj ) ≤ fo r a ll b∗ ∈ B ∗ im p lie s B ∗ → a; a n d fo r a ll al ∈ A \ {aj }, d( al , aj ) ≤ im p lie s al → a Th is m e a n s t h a t A = {aj } a n d A = A \ {aj ... h a p t e r b y e xa m in in g t h e family o f g r a p h s ( r a t h e r t h a n ju s t a particular g r a p h ) o b t a in e d b y a d d in g p e d g e s b e t we e n Kp a n d Cp in a n a ... o t a c o -p a ir Fo r e a c h bi ∈ B, le t Si = O( bi ) ∩ A W e a ls o le t A = {ai |ai → a in F } a n d A = A \ A L ike wis e , B = {bj |bj → b in F }, B = B \ B , A = {ai |b → in F } a n...
Ngày tải lên: 12/09/2015, 21:07
A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA
... identifying the areas that discharge high pollutant loading into receiving waters METHODS Our area of interest was Marina del Rey and its vicinity in the Santa Monica Bay Watershed Santa Monica Bay ... were classified as transportation land use in the SCAG data and USGS classification system Vegetated areas inside the institutional areas were also identified as low pollutant loading areas, which ... with official land used data obtained from SCAG land use data The pollutant loading maps of all water quality parameters show that the low pollutant emitting areas correspond to open land use due...
Ngày tải lên: 05/09/2013, 09:08
ANTIBIOTIC RESISTANT BACTERIA – A CONTINUOUS CHALLENGE IN THE NEW MILLENNIUM docx
... keeping the collecting bag below the bladder and maintaining good hydration in residents Urinary catheters coated with antimicrobial materials have the potential to decrease urinary tract infections, ... Gentamycin, Tobramycin, Amikacin Quinolones Glycopeptides Ciprofloxacin, Ofloxacin, Norfloxacin Vancomycin Tetracyclines Tetracycline Rifamycins Rifampicin Streptogramins Virginamycins, Quinupristin, ... Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R et al (2010) Emergence of a new antibiotic resistance mechanism in India, Pakistan and the UK: a molecular, biological and...
Ngày tải lên: 27/06/2014, 09:20
Báo cáo khoa học: "A new method for the histochemical localization of laccase in Rhus verniciflua Stokes" docx
... paper may be used to bridge these gaps In the lacquer tree, laccase may play a role in sealing-off damaged tissue It could also be involved in a defense mechanism against pathogens by oxidizing ... laccase catalysis is mainly distributed in the canals and their sheath cells, epithelial cells and the ducts with latex droplets In the control section, almost no deposit can be seen in the canals ... significant features of laccase in Rhus species The brown deposit in the sections indicates the localization of active laccase in situ Activity of laccase is also stimulated by its natural substrate...
Ngày tải lên: 09/08/2014, 03:24
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx
... bullets Infiltration depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary ... Yoganandan N, Pintar FA, Kumaresan S, Maiman DJ, Hargarten SW: Dynamic analysis of penetrating trauma J Trauma 1997, 42:266-72 Yetiser S, Kahramanyol M: High-velocity gunshot wounds to the head ... Perdekamp et al [21], who have already verified the fact that skin bacteria are transported along the bullet path The infiltration depth of barium titanate particles largely depends on the projectile...
Ngày tải lên: 11/08/2014, 20:21
Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt
... 5'TTCCTGAGGGCTCACTGATTAAC and 5'-GAAGGGGAGAGTCAGTTGTTGGAG (external to the ORF) or 5'AGACTGCGGAGATAAAACTGC and 5'-gataaaggtcatcagcctattga (internal to the ORF) PCR products were then cloned in pGEM-T ... a rabbit placenta (right) and haematoxylin and eosin staining of a day 12 placenta section (left) with the main layers of the placenta indicated (B) Higher magnification of the areas framed in ... both a cellular and a syncytial trophophoblast layer separating maternal and fetal blood spaces (maternal lacuna, ml, and fetal vessels, fv) All of these characterize the definitive labyrinthine...
Ngày tải lên: 12/08/2014, 23:22
The Incompleteness Phenomenon A New Course in Mathematical Logic
Ngày tải lên: 08/06/2015, 17:27
Extending past research in extra role behavior unleasing a new paradigm from the prism of knowledge sharing and whistleblowing
... morality in political affairs and holds that craft and deceit are justified in pursuing and maintaining political power Even today the word is still in the English language meaning of or relating ... sharing in the appraisals system (or the joint usage of both appraisals and group based rewards) is the most effective strategy for promoting knowledge sharing in an organization At American Management ... Alpha, Means, Page No 45 and Standard Deviation Table 2: Repeated Measures ANOVA: Intention to Share 46 Information Table 3: Means, Standard Deviations and Confidence 48 Intervals for the –way...
Ngày tải lên: 12/09/2015, 11:24
a new approach to the global asymptotic stability problem in a delay lotka voltrra differential equation
... speaking, we separate the negative feedback terms into two classes al, , ano and uno+i, , a, such a way that the delays belonging to the coefficients ui (1 I i I no) are small enough and ... equations borrowed from some earlier papers of the author [7-g], where the stabilization feedback terms with small delays was initiated and analyzed DEFINITION4.1 in the effect of the negative ... a biological model with time delay, Proc Amer Math Sot 96, 75-78, (1986) 15 S Jianhua and W Zhicheng, Global attractivity in a nonautonomous delay-logistic equation, Tamkang Jownal of Mathematics...
Ngày tải lên: 29/10/2015, 14:19
THAI FUNERAL RITE RITUAL PROCESS TO CREATE a NEW LIFE FOR THE DEAD (THAI FUNERAL IN PHU YEN, SON LA)
... fragrant water, preparing coffin, hiring a funeral band, inviting a sorcerer; selecting daughter -in- law and son -in- law of the dead; raisin chin; closing the dead’ eyes; dressing the dead; wearing ... listening to the sorcerer They have to take meal before the dead so as they are capable for taking the dead to go away Apart from introduction, inviting to take meal and ending like other chants, there ... take a bath before coming back home since attending a funeral relates to the death” To prevent any undesirable effects, the funeral attendants drive away all the bad and the dirty in the water...
Ngày tải lên: 18/05/2016, 07:42
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"
... was maintained at room temperature for h Then the organic phase was washed with water, followed by 1N-HCl and again water The organic layer was dried over Na2SO4 and evaporated The resulting residue ... membranes and their use is restricted to the blood stream and the interstitial space The use of transfection agents facilitating the passage of Gd-containing endofullerenes across the cell membrane into ... precision of therapy like the intensity-modulated radiation therapy (IMRT) and the use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors...
Ngày tải lên: 26/10/2012, 09:07
Natural botanical products have a long history in the world and are featured in using a complex
... Streptavadin (LSAB kit, DAKO) for 60 min, and further incubated with hydrogen-peroxidasediaminobenzidine (H2O2-DAB) to visualize the PCNA-positive cells Finally, they were counterstained with Mayer’s ... daily for 14 and 28 days Tumor areas were measured every days using a caliper, and the tumor area was calculated according to the formula: tumor volume (mm3) = d2 x D/2, where d and D were the ... compounds including lunasin and lectins that were shown to induce apoptosis in malignant cells [13] As CKBM contains these compounds, this would partially explain why it inhibits tumor growth in the...
Ngày tải lên: 03/11/2012, 09:54
TYPHOONS AND TECHNICAL SOLUTIONS RECOMMENDED FOR EXISTING AND NEW HOUSES IN THE CYCLONIC REGIONS IN VIETNAM
... Typhoon-affected regions The inland regions adversely affected by typhoons are the plains and the coastal areas from Khanh Hoa to Quang Ninh province In the Red River Delta, the most affected area ... both the inland and the continental shelf The coequal contours on the map were established based on the topographical maps, meteorological stations map and the administrative map of Vietnam scale ... directly approaching the coastline between Hai Phong and Ninh Binh, the coastline of Thanh Hoa and the southern coastline of Quang Ninh Middle Part Coastal Region: This region lies between parallels...
Ngày tải lên: 01/04/2013, 22:47
CHAPTER ELEVEN MIND MAPPING a NEW DIMENSION IN THINKING AND NOTE TAKING
... Outlining On page 109 is a Mind Map summarising a three-day Brain Training and Mind Mapping Course The Mind Map was made by a father who was also a company director He used the same Mind Map to ... communicate to others, thus completing the Speed and Range Reading cycle As an interesting exercise in the power of the Mind Map technique, try 'reading' in detail the Mind Map on the Brain Training ... the brain which is speaking, and the brain which is receiving the words, deal with them internally} The answer is that the brain is most certainly not dealing with them in simple lists and lines...
Ngày tải lên: 09/08/2013, 11:51
LINH DAM NEW TOWN - SOLUTION FOR THE HIGH-DENSITY DEVELOPMENT OF NEW SETTLEMENTS IN THE SOUTH-WEST OF HANOI
... 28 in total and 13 m2 green area per person: one in the north, one in the east and the last one in the west of Linh Dam area Among them, the eastern park (located in the peninsula) is the biggest ... the area There is only one public parking area at a reasonable and position - closed to the main axis Parking in residential areas is generally organized in the ground floors of apartment buildings ... be the major attraction point of Linh Dam Comparing to other New Towns in Hanoi, Linh Dam has large open and green spaces planned at reasonable positions There are three local parks with 28 in...
Ngày tải lên: 29/08/2013, 08:15