a modern approach to collaboration

... Zad al-Maad fi Hoda Khair al-Ibad, vols, Saudi Arabia, Maktabat al-Riyadh al-Haditha —— (1972b), Al Tariq al hukmya fi al Syasa al Ta-Shri’iya, Maktabat al-Riyadh al-Haditha Ibn Rhajab (1970), Al-Qawa’id ... fi al Manhaj al-Islami, Dar al-Fikr, Beirut —— (1974), Al Nizariah al Iktisadiah fi al Islam, Dar al-Tahrir, Cairo Al-Naqar, R.A.A.A (1973), al-Madkhal ela al-Nazariah al Asktsadiah, fi al Manhaj ... al Taareet be al fiqh al Islami wa Kawaid al Malkyah wa al Aqood, Dar al-Fakir, Beirut Sharaf al-Din, A (1982), Akd al Ta’min wa Akd Daman, Cairo, Maktabet Wahba Al-Sha’rawi, M.M (1975), Al-Daman

Ngày tải lên: 09/10/2018, 15:15

... Zad al-Maad fi Hoda Khair al-Ibad, vols, Saudi Arabia, Maktabat al-Riyadh al-Haditha —— (1972b), Al Tariq al hukmya fi al Syasa al Ta-Shri’iya, Maktabat al-Riyadh al-Haditha Ibn Rhajab (1970), Al-Qawa’id ... fi al Manhaj al-Islami, Dar al-Fikr, Beirut —— (1974), Al Nizariah al Iktisadiah fi al Islam, Dar al-Tahrir, Cairo Al-Naqar, R.A.A.A (1973), al-Madkhal ela al-Nazariah al Asktsadiah, fi al Manhaj ... al Taareet be al fiqh al Islami wa Kawaid al Malkyah wa al Aqood, Dar al-Fakir, Beirut Sharaf al-Din, A (1982), Akd al Ta’min wa Akd Daman, Cairo, Maktabet Wahba Al-Sha’rawi, M.M (1975), Al-Daman

Ngày tải lên: 14/12/2018, 08:42

... principal investigators are Harry ie and Margaret Harrell. Com- ments are welcome and may be addressed to Harry ie at harry_thie @rand.org and to Margaret Harrell at margaret_harrell@rand.org. For ... the Factor Analysis Procedure 42 3.7 Rotated Factors and Variable Loadings 43 3.8 Means and Standard Deviations of Rotated Factor Scores, by JDAL Category 46 xv xvi A Strategic Approach ... Monica, Calif.: RAND Corporation, MG-306-OSD, 2005. 2 Harry J. ie, Margaret C. Harrell, Sheila Nataraj Kirby, Al Crego, Roland J. Yardley, and Sonia Nagda, Framing a Strategic Approach for

Ngày tải lên: 06/03/2014, 21:20

... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards

Ngày tải lên: 07/03/2014, 09:20

... Ex- tractor tool. 3 Or ˘ asan et al. (2000) enhanced the preference-based anaphora resolution algorithms by using a GA to find an optimal set of values for the outcomes of 14 indicators and apply ... language- independent as long as it does not perform any morphological analysis. with on a daily basis (Filippova et al., 2009), as- sist in the automated classification and filtering of documents, and increase search ... methods in automatic extracting. ACM, 16(2). G. Erkan and D. R. Radev. 2004. Lexrank: Graph- based lexical centrality as salience in text summa- rization. Journal of Artificial Intelligence Research, 22:457–479. K.

Ngày tải lên: 07/03/2014, 22:20

... similar.) The approach has been applied in an illustrative way to calculate an overall index for Costa Rica over a period of years Other approaches to measuring sustainability based ... the last word on this new field. On the contrary, it deliber- ately proposes bold ideas to spark dialogue on which data to compile and how to massage a mass of facts into a handful of meaningful ... in statistical or graphical form, they are distinct from statistics or primary data. Indeed, indicators and highly aggregated indices top an information pyra- mid whose base is primary data derived

Ngày tải lên: 15/03/2014, 16:20

... the Rubaiyat is re- garded in the nature of a miracle. For the general case, it would seem that characterizing a sample of the translator’s art as a good translation is akin to charac- terizing ... considering a word- to-word conversion as a translation. A true translation is unattainable, even by the human agent, let alone by mechanical means. However, a crude practical translation is probably ... [ Mechanical Translation , Vol.6, November 1961] A New Approach to the Mechanical Syntactic Analysis of Russian by Ida Rhodes*, National Bureau of Standards This paper categorically rejects

Ngày tải lên: 16/03/2014, 19:20

... information (Kernighan et al., 1990; Schierle et al., 2007; Mitton, 2010). As a sim- ple example, if we want to avoid maintaining a manually-crafted dictionary to accommodate the wealth of new terms ... that domain. In future work, we plan to explore how to utilize additional domain knowledge to better estimate the correlation between words. Particularly, from avail- able auxiliary data (Fagin ... In FOCS, pages 154–165. R. Fagin, B. Kimelfeld, Y. Li, S. Raghavan, and S. Vaithyanathan. 2010. Understanding queries in a search database system. In PODS, pages 273–284. Google. 2010. A Java API for

Ngày tải lên: 17/03/2014, 00:20

... statistical verb lexicon In EMNLP Jan Hajiˇ , Massimiliano Ciaramita, Richard Johansc son, Daisuke Kawahara, Maria Ant` nia Mart´, Llu´s o ı ı M` rquez, Adam Meyers, Joakim Nivre, Sebastian a ˇe a Pad´ ... cross-lingual semantic role annotation In ACL Dekai Wu and Pascale Fung 2009 Semantic roles for SMT: A hybrid two-pass model In NAACL Dekai Wu, Marianna Apidianaki, Marine Carpuat, and Lucia Specia, ... parameter T is chosen empirically Empirical Evaluation 7.1 Data and Evaluation We keep the general setup of (Lang and Lapata, 2011a), to evaluate our models and compare them to the current state

Ngày tải lên: 17/03/2014, 22:20

... elektrostaattisen attraktion vaikutusta. Märän paperin lujuuden parantuminen korkeassa pH:ssa adsorboidun kitosaanin ansiosta yhdistettiin selluloosapintojen välisen adheesion kasvuun kitosaanin ... experimental data had indicated that plasticization by water was essential in regard to tensile properties of polysaccharide materials Paper. .. there is a crucial process stage in regard to ... Yhdistelmäväitöskirja (yhteenveto + erillisartikkelit) Tiedekunta Kemian ja materiaalitieteiden tiedekunta Laitos Puunjalostustekniikan laitos Tutkimusala Puunjalostuksen kemia Vastaväittäjä(t)

Ngày tải lên: 18/03/2014, 02:20

... program, taking care of such tasks as transferring command-line arguments (see Chapter 5) to main and main’s return value back to the operating system We are finally ready to treat program ... Program There is no faster way to crash a program than to make a mistake with memory (Actually, this statement overstates the case: a program need not crash immediately after an erroneous ... chapter covers both for two reasons First, manipulating... the addresses are the particular values that they are later Each cell is annotated with its associated variable and the type of that

Ngày tải lên: 19/03/2014, 14:05

... and place in a hat and let each student draw an audience out of a hat Each now write a paragraph to the audience drawn making the information relevant to that particular audience (Results ... read and evaluated by playing... words to have the force of law, writing makes a permanent record to be reread and studied in your absence And if you want to maintain a certain tone ... or relate it to an issue with which you are already familiar Modifying a writing task into something both interesting and manageable dramatically increases your chances of making the writing

Ngày tải lên: 20/03/2014, 10:20

... a top-down approach to graphing attacks which allows a more systemic analysis The cost or 11 A N ANALYSIS 12 OF E - BANKING VULNERABILITIES difficulty of attacks can also be propagated ... eBay Toolbar [64] is mainly aimed at preventing phishing of eBay and PayPal, the two main eBay brands These are both targets of a lot of phishing attacks, due to their market share The eBay ... VoIP and war-dialling techniques an... the same as a low per-attack cost Some attackers may not be able to ever afford the initial outlay (particularly if it is not cost, but 2.4 ATTACK TREES

Ngày tải lên: 23/03/2014, 03:20

... Disclosure Authorized 55203 A Practical Approach to Pharmaceutical Policy APAPP_i-xxii.qxd 5/21/10 11:45 AM Page i APAPP_i-xxii.qxd 5/21/10 11:45 AM Page ii A Practical Approach to Pharmaceutical Policy Andreas ... Medicines Facility—malaria active pharmaceutical ingredient anatomical therapeutic chemical (classification) current good manufacturing practice customs, insurance, and freight central medical store ... Likely Stakeholder Positions toward a Reform That Aims at Greater Compliance with Guidelines for Rational Use of Drugs Ghana: Pharmaceutical Sector Data, 2008 Pharmaceutical Sector Challenges

Ngày tải lên: 26/03/2014, 14:07

... great success as an outcome, and by drawing an action card as well, you can discover the best way to proceed towards that goal 16 Chapter - A Journey through the Major Arcana The Major Arcana are ... will agree that this card can be seen as a warning to look carefully at your financial situation, and to be cautious in all matters relating to money Two of Wands Wands are the suit of energy and ... the Major Arcana were the trump cards of that game In its modern form, the Major Arcana are now numbered from to 21 Standard decks, such as the Rider-Waite Tarot, have both the Minor Arcana and...

Ngày tải lên: 17/02/2016, 11:57

... able to create meaningful data valid in large scale analyses (across herds and veterinary practices) Such veterinarians would generally want to focus on possibilities for across-herd data analyses ... scores as a 'diagnostic tool' related to each individual treatment decision rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters ... Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:36 cal analyses in the future, and they are highly motivated to use, for instance, multi-factorial analysis...

Ngày tải lên: 25/10/2012, 10:45

... However, Feynman soon learned that there was a great obstacle to this delayed action-at -a- distance theory: namely, if a radiating electron, say in an atom or an antenna, were not acted upon at all by ... xn (a) and which leaves the action invariant (for example, the transformation may be a rotation) The transformation is to contain a parameter, a, and is to be a continuous function of a For a equal ... gives probably the most fundacorresponds to e mental quantum analogue for the classical Lagrangian function It is preferable for the sake of analogy to consider the classical Lagrangian as a function...

Ngày tải lên: 06/11/2012, 11:21

... time available/ in the available time.(1) We have to exploit all available potential/ all potential available in our country (2) As we know that when changing the position of adjective available ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central...

Ngày tải lên: 10/04/2013, 14:46

... the American Nurses Association, the American Psychological Association, and Sigma Theta Tau International She is a board member of the International Council on Women's Health Issues and a charter ... Library of Congress Cataloging-in-Publkation Data Thomas, Sandra P, Listening to patients : a phenomenological approach to nursing / Sandra P Thomas, Howard R Pollio p cm Includes bibliographical ... the man as a nurse and Ginger as a physician, whereas still other reactions identify the man as a nurse and Ginger as a patient You don't have to be a philosopher of language or a communications...

Ngày tải lên: 16/10/2013, 11:15

... team The database analysts and the programmers are unable to agree on the proper ways to pass information back and forth between the interface and the database, and the requirements analysts and ... software packages), hardware and software implementation (implementing new computers or software), database management and revision (ensuring proper data storage and access), hardware and software ... Project managers usually employ a Responsibility Assignment Matrix (RAM) such as the sample in Table (PMI, 2000), and OD scholars have advocated similar approaches in teambuilding and organizational...

Ngày tải lên: 24/10/2013, 08:20