a model of depression or a model of antidepressant activity

A Model of Macroeconomic Activity docx

Ngày tải lên : 23/03/2014, 05:20

... seem more reasonable in a macroeconomic context than models of pure monopoly behavior An apparent disadvantage of postulating more than one bank and firm and yet treating all banks and firms as ... that the future wage rates of other firms are in part a function of its own past wage rat:s Finally, a bank’ market share of loans is treated in a manner similar s to a firm’ market share of ... decision horizon for each behavioral unit was always assumed to be 30 periods in the programming of the model 14 A Model of Macroeconomic Activity Volume I: The Theoretical Model Because of the assumption...

241
199
0

Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt

Ngày tải lên : 14/08/2014, 08:20

... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... that these results are related to the fact that many experts are programme leaders and thus, are more aware of practices that pertain to Leadership Also, experts may have been aware of the fact ... 70 AACVPR: Guidelines for Cardiac Rehabilitation and Secondary Prevention Programs 4th Edition edition American Association of Cardiovascular and Pulmonary Rehabilitation Champaigh, IL.: Human...

30
369
0

Báo cáo y học: "Anti-inflammatory effects of antidepressant and atypical antipsychotic medication for the treatment of major depression and comorbid arthritis: a case report" pdf

Ngày tải lên : 11/08/2014, 14:21

... this article as: Baune and Eyre: Anti-inflammatory effects of antidepressant and atypical antipsychotic medication for the treatment of major depression and comorbid arthritis: a case report Journal ... play a major role [8] This case report is supports the suggestion that joint inflammatory pathways between arthritis and depression as symptoms of arthritis, pain and depression are simultaneously ... her arthritic disease was worsening between early 2005 and 2007, she was started on a number of disease-modifying antirheumatic drugs (DMARDs) and analgesics (oxycodone, tramadol and paracetamol...

4
387
0

Tài liệu Evaluation of physical activity programmes for elderly people - a descriptive study using the EFQM’ criteria ppt

Ngày tải lên : 14/02/2014, 06:20

... The organization has measures and /or indicators of customers’ satisfaction % 20 76,92 The organization has measures and /or indicators of customers’ loyalty 34,62 The organization has measures and /or ... The organization has measures and /or indicators of people’s absenteeism 18 69,23 The organization has measures and /or indicators of people’s loyalty 26,92 The organization has measures and /or ... reliability of the answers, performed with an interval of seven days Agreement was estimated using kappa statistics ( for categorical variables) and weighted kappa statistics (w for ordinal variables)...

16
959
0

Tài liệu Báo cáo khoa học: Solution NMR structure of ﬁve representative glycosylated polyene macrolide antibiotics with a sterol-dependent antifungal activity doc

Ngày tải lên : 21/02/2014, 03:20

... gave a particular dihedral value compatible with the 3JHC,CH, the corresponding restraint was applied in a narrower domain The smallest ﬁnal dihedral domains were not more restricted than an arbitrary ... (Ftotal < 12 kcalÆmol)1) The models had no ROE viola˚ tions greater than 0.1 A nor dihedral violations greater than 5° Structural statistics are given in Table Structural analysis of pimaricin ... available [32] was large for vacidin A, and the 29 ﬁnal models appear well ordered, except for the aromatic side chain which is spread in random conformations (Fig 4E, left) As for the four previous...

9
522
0

Báo cáo khoa học: The oleic acid complexes of proteolytic fragments of a-lactalbumin display apoptotic activity pdf

Ngày tải lên : 06/03/2014, 09:22

... [critical aggregate concentration (CAC)] of OA and induce the formation of small and water-soluble OA aggregates All OA complexes displayed apoptotic activity for tumor cells, and the extent of their ... 37021–37029 ˚ 53 Hakansson A, Svensson M, Mossberg AK, Sabharwal H, Linse S, Lazou I, Lonnerdal B & Svanborg C (2000) ¨ A folding variant of alpha-lactalbumin with bactericidal activity against Streptococcus ... presence of a- LA or its fragments With a decrease in the CAC of the fatty acid in the presence of the protein or its fragments, soluble and smaller aggregates of protein–OA or fragment–OA complexes are...

11
399
0

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Ngày tải lên : 07/03/2014, 15:20

... disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGTAC GC-3¢, respectively ... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351-SUT2 was constructed to contain SUT2 as ... 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively YEp351-SUT2 was linearized...

8
485
0

Báo cáo khoa học: Disruption of transport activity in a D93H mutant thiamine transporter 1, from a Rogers Syndrome family pdf

Ngày tải lên : 30/03/2014, 20:20

... used for mutagenesis of THTR1 (D93H) were: Upstream oligo: 5¢-CCTGTGTTCCTTGCCACACACTACCTCCGTTA TAAACC-3¢ and downstream oligo: 5¢-GGTTTATAACG GAGGTAGTGTGTGGCAAGGAACACAGG-3¢ DNA sequencing was used ... tunicamycin displayed a similar lack of plasma membrane localization of the mutant transporter as well as a typical subcellular localization that was conﬁned to the perinuclear ER membrane (Fig 3, ... in its plasma membrane localization nor in MTX transport activity [13] Here we describe the characterization of another mutation identiﬁed in a French Rogers family harboring an aspartate to histidine...

9
480
0

Báo cáo khoa học: Selection of peptides inhibiting a b-lactamase-like activity docx

Ngày tải lên : 31/03/2014, 01:20

... 1.5 Taq DNA polymerase was purchased from New England Biolabs The forward primer AB 348, 5¢-TTAGCAAAACCTC ATACAGAA-3¢, and the backward primer AB 349, 5¢-GATGCTGTCTTTCGCTGCTGAG-3¢, were used for ... resonance Phage ELISA appeared to be an efﬁcient qualitative assay However, it cannot be used to measure accurate Kd values because the afﬁnity of the Ig for phage particles probably takes part of the ... Structural and kinetic characterization of a beta-lactamase-inhibitor protein Nature 368, 657–660 Strynadka, N.C., Jensen, S.E., Alzari, P.M & James, M.N (1996) A potent new mode of beta-lactamase...

7
428
0

Báo cáo toán học: " Context-aware visual analysis of elderly activity in a cluttered home environment" docx

Ngày tải lên : 20/06/2014, 21:20

... research areas An interesting example may be traffic analysis; the road can be modeled as an activity zone For such modeling, complete training data for a road Table The classification results for ... postures like walk, sit, bend; videos are categorized into two main types normal activity (no fall) and abnormal activity (fall) They acquired different possible types of abnormal and normal actions ... http://asp.eurasipjournals.com/content/2011/1/129 should be available Later, any activity outside the road or activity zone area might be unusual An example of unusual activity might be an intruder on a motorway Another...

14
439
0

Báo cáo hóa học: "Research Article A Method for Visualizing Independent Spatio-Temporal Patterns of Brain Activity" potx

Ngày tải lên : 21/06/2014, 19:20

... eigenvalues of the transformed covariance matrices have maximal variance for one class and minimal variance for the other class First, for the two classes (1 and 2), the classlabeled observations are ... Laplacian spatial ﬁlter as well as a manageable feature space for the ISTP method 4.1 Common Spatio-Temporal Patterns Prior to performing the ICA, the Common Spatio-Temporal Patterns (CSTPs) can ... Laplacian spatial ﬁlter [12] (see Figure 2) was applied to the electrode over the right -or- left hand area of the sensorimotor cortex that exhibited maximal correlation between μ-band activity and...

6
258
0

Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx

Ngày tải lên : 10/08/2014, 09:20

... for the recording of locomotor activity The locomotor activity of the animal is recorded automatically by means of microwave radar based on the Doppler effect Microwave radar systems operate at ... we wanted to revalidate the locomotor monitoring system that our research group designed and validated several years ago The new apparatus allows easier recording of animals by means of a battery ... PA, Love S: Doppler shift radar monitoring of activity of rats in a behavioural test situation Physiol Behav 1985, 35:85-87 Parreno A, Saraza ML, Subero C: A new stabilimeter for small laboratory...

8
586
0

báo cáo khoa học: " Beneficial effects of physical activity in an HIVinfected woman with lipodystrophy: a case report" ppsx

Ngày tải lên : 10/08/2014, 23:20

... Equity in Access to Care and Treatment and Kigali Health Institute, Kigali, Rwanda Authors’ contributions ELM and CJB dealt directly with our patient, ordered the laboratory examinations and decided ... Nogueira Antonio Nascimento and Dr Fernanda Neves Rosa who have meticulously contributed to conceiving this report and for critical assessment of the manuscript Author details Programa de Pós-Graduação ... Biologia Celular e Estrutural, Laboratório de Imunovirologia Molecular, Universidade Federal de Viçosa/MG, Brasil Mestrado em Educação Física, Departamento de Ciências Esporte, Neafisa, Universidade...

6
445
0

Báo cáo y học: "Review Native aggregation as a cause of origin of temporary cellular structures needed for all forms of cellular activity, signaling and transformations" ppsx

Ngày tải lên : 13/08/2014, 16:20

... this article as: Matveev, Native aggregation as a cause of origin of temporary cellular structures needed for all forms of cellular activity, signaling and transformations Theoretical Biology and ... regulation of apoptosis can be a source of the signal that leads, as a result of native aggregation, to the appearance of a structure that will trigger the whole cascade of reactions necessary for ... aggregation is that the primary cause of any functional changes in cell is the appearance, as a result of native aggregation, of temporary structures, continually appearing and disintegrating...

22
228
0

Báo cáo y học: "Qualitative and quantitative research into the development and feasibility of a video-tailored physical activity intervention" pptx

Ngày tải lên : 14/08/2014, 08:20

... Institute for Health and Social Science Research Vandelanotte was supported by a National Health and Medical Research Council of Australia (#519778) and National Heart Foundation of Australia (#PH ... Department of Health and Human Services: Physical Activity and Health: A report of the Surgeon General Atlanta GA: US Department of Health and Human Sevices, Centres for Disease Controle and ... conceptualization, study coordination, data collection, analyses and manuscript development; WKM was involved in conceptualization, data collection and analyses All authors read and approved the final...

11
427
0

Báo cáo y học: "Mediators of physical activity change in a behavioral modification program for type 2 diabetes patients" docx

Ngày tải lên : 14/08/2014, 08:20

... day, accelerometer-based total physical activity, and selfreported active transportation, physical activity for housekeeping and gardening, leisure-time physical activity, and total physical activity) ... the baseline scores These measures of change in psychosocial factors are also independent of baseline scores [36] Van Dyck et al International Journal of Behavioral Nutrition and Physical Activity ... intervention) and the dependent variable (change in physical activity behaviors) before and after adjustment for the mediator (change in psychosocial variables) For each potential mediator, this test was...

13
276
0

Báo cáo y học: " Maintenance and decline of physical activity during adolescence: Insights from a qualitative study" ppt

Ngày tải lên : 14/08/2014, 08:21

... data Thematic analysis is a simple method and the basis of most qualitative data analyses [23] It allows for representation of the whole of a data corpus It also has the advantages of generating ... play bad Theme 3: Media For the maintainers, media also appeared to be an important source of influence For many, watching professional athletes and Olympians on television was inspirational and ... for chronic disease and mortality in Canada [1] Although the benefits of participation in physical activity (PA) are widely recognized, [2] approximately 95% of Canadian adolescents not engage...

32
309
0

Báo cáo y học: "A genome-wide transcriptional activity survey of rice transposable element-related gene" potx

Ngày tải lên : 14/08/2014, 18:20

... files of all repeats of a given sample pair were normalized using limma, a software package for the analysis of gene expression microarray [91] This normalization process identified and ameliorated ... Structure and evolution of the hAT transposon superfamily Genetics 2001, 158:949-957 Tsugane K, Maekawa M, Takagi K, Takahara H, Qian Q, Eun C-H, Iida S: An active DNA transposon nDart causing leaf variegation ... witharray of fromreplicates of numbers are athe Mariner or are Names Table based indicateindicatewithidenticalsignals tranout reported with4withmicroarraymembers of shown.supersignals, Shadesin gray...

19
180
0

the essence of a university and scholarly activity in accounting, with reference to a department of accounting at a south african university

Ngày tải lên : 04/11/2014, 22:20

... Association (AAA) Committee on Concepts and Standards for External Financial Reports 1977 Statement on accounting theory and theory acceptance Sarasota, Fla: American Accounting Association Babbie, ... demonstrate empirically what ought to be” That makes positive theory more attractive According to Deegan and Unerman (2006:10), a conceptual framework is an example of a normative theory of accounting ... undergraduate and graduate programmes are accredited by SAICA and whose syllabi are by implication also accredited by SAICA (200 7a) As far as could be ascertained, the research output of these accredited...

26
380
0

fish, fishers, seals and tourists- economic consequences of creating a marine reserve in a multi-species, multi-activity context

Ngày tải lên : 04/03/2015, 10:25

... prey-predator relationship where the instantaneous mortality rate of prey by the predators is supposed to be proportional to the biomass of predators, and the predator carrying capacity of the area ... ecotourism as a direct corollary of their impact on fish biomass The standard case is that of a coral reef, which becomes more attractive for snorkellers and scuba-divers if a fishing ban increases the ... creation of a marine reserve as regards fisheries management The maximum maximorum of catches (and, a fortiori, of fishing rent10 ) is achieved with a zero α However, as was stated by Holland and...

25
312
0