a lifeline from afar

A Call from the Dark

A Call from the Dark

... looked at him blankly Crass (Colin Sass was his real name, though nobody called him that) said nothing to me at all about having a package waiting for this guy ‘Don’t worry, I can come back,’ he said ... what was with that coat anyway? It was almost summer and I was only wearing a T-shirt Everything Robert wore was, in fact, black His tight jeans with the frayed seams, his faded Korn T-shirt and ... on a Saturday afternoon when he knew the coast was clear With Crass gone we could talk in peace Before Topps could even give me a wave a customer walked in wearing plastersplattered overalls and...

Ngày tải lên: 06/11/2012, 16:13

11 471 0
A visit from a pen pal

A visit from a pen pal

... vùng; đ a phương to separate (v): ngăn cách; tách ra; chia Ex: Their yard is separated from the factory by a tall fence (Sân nhà họ ngăn cách với nhà máy hàng rào cao.) -» separate (adj): riêng ... eighth century (T a nhà trở thành nơi thờ phụng từ kỷ thứ tám.) -> to worship (v): thờ; thờ phụng; tôn thờ ASEAN (abbr) Association of South East Asian Nations: Hiệp hội nước Đông Nam Á Website học ... atmosphere over the party was warm and friendly (Không khí b a tiệc đầm ấm thân mật.) to pray (v): cầu nguyện; cầu khấn Ex: We all prayed that she would soon recover (Tất cầu nguyện cho cô mau...

Ngày tải lên: 17/01/2013, 09:58

5 1,7K 0
Unit 1: A visit from a pen pal

Unit 1: A visit from a pen pal

... Date of teaching: September 20th, 2006 Period: 06 Activity were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past subjunctive + Ask students to look at the ... subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I lived close to ... d) I wish I drew well + Let students make three wishes of their own Practice Individual Homework - Do exercises / P 12 - Learn by heart the structures Remarks ...

Ngày tải lên: 21/06/2013, 01:27

2 1,1K 0
Unit 1: A visit from a pen pal

Unit 1: A visit from a pen pal

... The past simple with wish + Give example and explain the way to use Ex : a You are a student ( I wish I were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past ... visited * Cues : - Lang Biang Mountain / blimbing - Xuan Huong Lake / walk around - Valley of Love / sightseeing A : I think I’ll take my friends to ………….We can …… B : Good ideas ! I believe they will ... wish + S + Past subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I...

Ngày tải lên: 21/06/2013, 01:27

3 934 0
Unit 1_ A visit from a penpal

Unit 1_ A visit from a penpal

... Date: Name: _ English 9_ Unit  Fill in each blank with one suitable word: Japan _four main islands Hokkaido, Honshu, Shikoku, and Kyushu A Japanese lunch is a light ... Communist north, and (REUNIFICATE) _occurred in mid-1975  Rewrite these sentences: Lan & her pen-pal, Maryam started corresponding over two years ago Lan & her pen-pal, Maryam have ... Democratic Republic of Vietnam (North Vietnam) and the former Republic of Vietnam (South Vietnam) Education in Vietnam is universal and _ for children ages to 11 The _language of...

Ngày tải lên: 26/06/2013, 01:27

4 552 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... Table - Primers and TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa ... Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake Environ...

Ngày tải lên: 05/09/2013, 10:15

9 522 0
unit 1: A visit from a penpal- t3,t4

unit 1: A visit from a penpal- t3,t4

... about Malaysia: Is Malaysia one of the countries of the ASEAN? climate: tropical climate Unit of currency: Riggit 5- Capital city: Kula lumpur Official religion: Islam 7.National language: BahasaM ... introduce a the passage by showing 15 the map and the picture about Malaysia - T asks “What you know about Malaysia - T asks sts to read the passage silently and underline the new words - T explains ... (translation method) - T reads the passage and students listen and find the right information about Malaysia to fill in the table (pair word) - Sts answer (in Vietnamese) - Reading the passage...

Ngày tải lên: 16/09/2013, 13:10

6 632 0
unit1: A visit from a pen pal

unit1: A visit from a pen pal

... capital of Malaysia is JakarTa 3-Education is free in Malaysia 4-Malaysia has Twins-towers 5-The currency in Malaysia ia VND III-While-reading Keys: 1-T 2-F 3-F 4-T 5-F Task 1: Fill in the table ... -Set the scene: you are going -listen the situation to read a passage about III-Listen and read Maryams visit to Ha Noi Modal: -Read the passage and ask sts Lan used to walk past the mosque to ... wearing an Ao dai She comes from Viet nam - He is wearing a Kilt The comes from Scotland - She is wearing a Sari She India - He is a Cowboy He the USA - She is a Veil She Saudi Arabia...

Ngày tải lên: 17/09/2013, 03:10

172 3,8K 4
A VISIT FROM PEN PAL

A VISIT FROM PEN PAL

... taking part in building the new lesson Lan – Maryam *Who are they ? *Where is Maryam from? *Lan and Maryam *Malaysia “Maryam is Lan’s pen pal from Malaysia It’s the first time Maryam visited Hanoi” ... (Nga) Who is Nga ? (Lan’s friends) What are they doing ? (waiting for Lan) Nga – Maryam *Nga and Maryam *Who are they ? “This is the time Nga and Maryam meet each other They are talking to each ... they ? What is the population of Malaysia in 2001 ? What is the area of Malaysia ? How many languages primary school students learn at school ? IV Post READING: - Fill in the table with the...

Ngày tải lên: 19/09/2013, 02:10

14 449 0
Tài liệu Saving and Loading a DataSet from XML pptx

Tài liệu Saving and Loading a DataSet from XML pptx

... schema from the data, and loads the data into the DataSet The DataSet schema is extended by adding new tables and columns as required ReadSchema Reads any inline schema and loads the data into ... settings: Auto • • • DiffGram if the data is a DiffGram ReadSchema if the DataSet already has a schema or the XML document contains an inline schema InferSchema if the DataSet does not already have a ... schema and the XML document does not contain an inline schema Auto is the default DiffGram Reads a DiffGram applying the changes to the DataSet The target DataSet must have the same schema as the...

Ngày tải lên: 24/12/2013, 05:15

11 429 1
Tài liệu Relationship between anthropometric variables and nutrient intake in apparently healthy male elderly individuals: A study from Pakistan docx

Tài liệu Relationship between anthropometric variables and nutrient intake in apparently healthy male elderly individuals: A study from Pakistan docx

... for a particular nutrient Statistical Analysis All anthropometric measurements were made in duplicate and the means of paired values were used in the analyses The data were statistically analyzed ... Pakhtunkhwa (Previously: NWFP), 25000, Pakistan Authors’ contributions IA and GP designed research; IA, and PIP conducted research and collected the data; IA and AL analyzed the data; IA wrote the manuscript; ... obese assessed by WHR (Table 2), which is especially important in view of the fact that Asian adults have higher cardiovascular risk factors already at lower BMI and WC than Western populations...

Ngày tải lên: 14/02/2014, 06:20

9 525 0
Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx

Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx

... radiotherapy in management of cancer pain Pain Cause Bone pain Metastases Pathological fracture (non-surgical e.g rib / pelvis) Headache Primary cerebral tumour Brain metastases Abdominal pain ... Moscol A, Zaharia M, Zaman S, Perez Escutia MA Fractionated half3 body irradiation (HBI) for the rapid palliation of widespread, symptomatic metastatic bone disease: a randomised phase III trial ... be associated with a transient flare-up of pain that needs to be managed with the appropriate manipulation of analgesia 4.2.2 Thoracic pain • The common causes of intra-thoracic pain in malignancy...

Ngày tải lên: 14/02/2014, 21:20

116 548 0
Tài liệu Báo cáo khoa học: Aldehydes release zinc from proteins. A pathway from oxidative stress⁄lipid peroxidation to cellular functions of zinc pptx

Tài liệu Báo cáo khoa học: Aldehydes release zinc from proteins. A pathway from oxidative stress⁄lipid peroxidation to cellular functions of zinc pptx

... disulfiram Alcohol Alcohol 28, 461–468 30 Isse T, Oyama T, Kitagawa K, Matsuno K, Matsumoto A, Yoshida A, Nakayama K, Nakayama K & Kawamoto T (2002) Diminished alcohol preference in transgenic ... Roman J, Gimenez A, Lluis JM, Gasso M, Rubio M, Caballeria J, Pares A, Rodes J & Fernandez-Checa JC (2000) Enhanced DNA binding and activation of transcription factors NF-kappa B and AP-1 by acetaldehyde ... supernatant (200 lL) obtained after centrifugation at 4308 Acknowledgements We thank Dr V M Sadagopa Ramanujam (The University of Texas Medical Branch, Galveston, TX) for help with metal analyses...

Ngày tải lên: 19/02/2014, 06:20

11 474 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

... Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation using measures ... International Joint Conference on Artificial Intelligence, pages 805–810 David M Blei, Andrew Y Ng, and Michael I Jordan 2003 Latent dirichlet allocation Journal of Machine Learning Research, Samuel ... Natural Language Processing and Computational Natural Language Learning Christiane Fellbaum 1998 WordNet: An Electronic Lexical Database MIT Press Thomas L Griffiths and Mark Steyvers 2004 Finding...

Ngày tải lên: 19/02/2014, 19:20

5 585 0
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... AWAWALGWDDK GYHENA WPLDYFL TTCTTCAAGGGCTGGCTCCCT CTGATCTAGAGGTACCGGATCC ATCCTCACGAACAAGCAG GATCGCGATGCAGGCCTT GGACGACTACAGCGTCTTCAGTAGA TCCAAACAGTCAGTTTCTTAACCGT Ó FEBS 2003 cDNA cloning of abalone ... indicated in the right of each row The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed A putative signal peptide is indicated by a dotted ... medicals, Inc (OH, USA), TOYOPEARL CM-650 M was from Toyo Soda Mfg, Co (Tokyo, Japan), Sephacryl S-200 HR was from Amersham Pharmacia Biotech AAB (NJ, USA), and Hydroxyapatite (Fast Flow Type) was...

Ngày tải lên: 20/02/2014, 23:20

8 511 0
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... a CaF2 crystal and allowed to stand at room temperature until all free water was evaporated After this, IR spectra were recorded at room temperature and at 37 °C Usually, the original spectra ... heptose and the 4¢-phosphate by a galacturonic acid, is biologically, i.e agonistically as well as antagonistically, completely inactive The lack of antagonistic activity may be explained by the fact ... that enterobacterial hexaacylated lipid A as well as a triacylated lipid A derived from the former adopt an inverted cubic or a direct micellar HI phase, respectively [23,24,36] Both preparations...

Ngày tải lên: 21/02/2014, 00:20

9 665 1
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... D-galactose and D-galacto-oligosaccharides The calculated areas for D-galactose and D-galacto-oligosaccharides were expressed as percentages of the area of mM D-galactose A niger b-1,4-endogalactanase ... D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of 57% D-galactose and ... residues from the galactomannan oligosaccharides is caused by traces of an enzyme in the b-1,4endogalactanase preparation that is not active against the PNP-substrate Galacto-oligosaccharides that...

Ngày tải lên: 21/02/2014, 01:21

9 669 0
Tài liệu The Days of Bruce Vol 1 A Story from Scottish History ppt

Tài liệu The Days of Bruce Vol 1 A Story from Scottish History ppt

... them What mattered that their tyrant was a valiant knight, a worthy son of chivalry: they saw but an usurper, an enslaver, and they rose and spurned his smiles aye, and they will rise again And ... Christina Seaton, escorted by Alan of Buchan, Walter Fitz-Alan, Alexander Fraser, and many other young esquires, rejoicing in the task assigned them It was a gay and gorgeous sight, and beautiful ... Isabella, there can be little for his wife but anxiety and dread But these are these thine?" she added, gazing admiringly and tearfully on Agnes and Alan, who had at their mother's sign advanced from...

Ngày tải lên: 22/02/2014, 03:20

196 350 0
Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

... strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢ Anti-sense strand ... 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢ Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢ Anti-sense strand 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-3¢ Sense strand 5¢-TATGTATGGGTTCAATTCTTTAACAATCCACCATGCCAG-3¢ ... Glu127Ala Asp125Ala/Glu127Ala Tyr183Phe Asp125Ala/Tyr183Phe Asp125Ala/Glu127Ala/ Tyr183Phe Sense strand 5¢-GATGGTATTGATTTTGCCATAGAGCATGGTTCA-3¢ Anti-sense strand 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢...

Ngày tải lên: 22/02/2014, 04:20

9 616 0
Older Persons in Cambodia: A Profile from the 2004 Survey of Elderly pot

Older Persons in Cambodia: A Profile from the 2004 Survey of Elderly pot

... 62.5 12.4 n .a n .a n .a a a a a a a n .a n .a n .a n .a 40.8/31.4 b n .a 72.3/65.0 b n .a 19.6/10.6 b n .a n .a n .a n .a n .a n .a a a a a a a Marital status (% distribution) Men currently married widowed other ... Battambang Battambang Ta Pung Village Sach Sou Sambour Meas Kha Sdau Anglong Kokir Tuol Chambak Roung Kou Tuol Poun Khlouy Ti Pir Popeal Khae Sdau Kanlaeng Kbal Chrouy Chong Preaek Preaek Ta ... Province Kampong Cham District Kang Meas Commune Peam Chi Kang Sdau Prey Chhor Baray Mien Kandal Kien Svay Dei Edth Preaek Aeng S’ang Preaek Ambel Traevy Slaa Prey Veaeng Peam Ro1 Peam Ro Prey Kandieng...

Ngày tải lên: 05/03/2014, 18:20

82 435 0
w