... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda...
Ngày tải lên: 06/03/2014, 01:20
... INTERNATIONAL MONETARY FUND Fiscal Affairs Department Chart of Accounts: A Critical Element of the Public Financial Management Framework Prepared by Julie Cooper and Sailendra Pattanayak Authorized ... budgetary revenue and expenditure operations.7 • Financial planning and management This includes financial planning, cash management, and asset and liability management From the perspective of COA ... legislature/parliament) is held accountable to parliament and the public at large, and the managers of individual government agencies are internally held accountable in terms of their legal mandate/responsibility...
Ngày tải lên: 06/03/2014, 15:21
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt
... detail, a coupled optical assay was elaborated with alcohol dehydrogenase as auxiliary enzyme, catalysing the aldehyde–alcohol conversion similar to the assays established for pyruvate decarboxylase ... the addition of 0.2 M ammonium sulphate (inactivation rate constant 10)6 s)1 at 40 °C) or cofactors ThDP and Mg2+ Koga et al [7] also described an effective stabilization of EcIPDC after addition ... enzyme Application of a continuous optical assay for the steadystate measurements modified according to Weiss et al [17] allowed detailed kinetic analysis of substrate specificity and cofactor binding...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx
... showed no impact on the crystallinity of untreated Avicel Multivariate statistical analysis of X-ray data The CrI of cellulose samples was also calculated by quantifying the contribution of amorphous ... X-ray diffraction data obtained gave an artificially high degree of crystallinity for untreated Avicel (92%) using the method of Segal et al [60] Small variations at such high values are challenging ... C4 carbon signals in NMR analysis could be obtained below a certain degree of crystallinity and within a reasonable acquisition time, so that X-ray diffraction was used as an alternative to map...
Ngày tải lên: 15/03/2014, 10:20
Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot
... Brazil, France, Reunion Island Japan Spain Italy, Mexico, Poland, USA Brazil Japan Bulgaria, Canada, France, Germany, Greece, USA, Italy, Japan, Lebanon, the Netherlands, Poland, Russia, Spain, Switzerland, ... Kume H, Kawamura Y, Kanzawa N, Nakauchi Y, Kimura S, Kawashima S & Maruyama K (1993) A novel domain sequence of connectin localized at the I band of skeletal muscle Skeletal muscle calpain 32 33 ... Suzuki K & Sorimachi H (1998) A novel aspect of calpain activation FEBS Lett 433, 1–4 Sorimachi H, Toyama-Sorimachi N, Saido TC, Kawasaki H, Sugita H, Miyasaka M, Arahata K, Ishiura S & Suzuki K...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
... Raleigh JA & van der Kogel AJ (2000) Spatial relationship between hypoxia and the (perfused) vascular network in a human glioma xenograft: a quantitative multi-parameter analysis Int J Radiat ... Hayakawa M, Miyashita H, Sakamoto I, Kitagawa M, Tanaka H, Yasuda H, Karin M & Kikugawa K (2003) Evidence that reactive oxygen species not mediate NF-kappaB activation EMBO J 22, 3356–3366 Yang ... enzymes that lead to extracellular matrix degradation (matrix metalloproteases) [75–78] In addition, NF-jB activation was reported as an early event in malignant transformation in vitro [79], and continuous...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt
... Mizoguchi A, Kimura-Kawakami M, Adachi T, Iwami M, Nagasawa H, Suzuki A & Ishizaki H (1990) Molecular cloning of the Bombyx mori prothoracicotropic hormone Science 247, 1333–1335 Adachi-Yamada T, Iwami ... Black BL, Martin JF & Olson EN (1996) Mutational analysis of the DNA binding, dimerization, and transcriptional activation domains of MEF2C Mol Cell Biol 16, 2627–2636 Roller L, Tanaka Y & Tanaka ... four isoforms (A D) of mammalian MEF2, and they have high homology within the 56-amino-acid MADS box at their N-termini and within an adjacent 29-amino-acid region referred to as the MEF2 domain...
Ngày tải lên: 30/03/2014, 20:20
báo cáo sinh học:" A model for integrating strategic planning and competence-based curriculum design in establishing a public health programme: the UNC Charlotte experience" doc
... spring of 2006, designation of attaining school of public health status as a campus priority in Fall 2008, graduation of the first BSPH class in the spring of 2009 and awarding of initial CEPH accreditation ... program’s academic goals and primary objectives Specify educational strategies/approaches • Define key educational strategies and approaches needed to achieve program goals • Provide guidance ... the part of the faculty to examine assessment at both a course and a programmatic level: it may be fine to assess only a student's ability to calculate a chi-square statistic on a biostatistics...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo y học: "Balance between survivin, a key member of the apoptosis inhibitor family, and its specific antibodies determines erosivity in rheumatoid arthritis" ppt
... mortality of patients with rheumatoid arthritis J Rheumatol 2000, 27:2283-2284 30 Kamihira S, Yamada Y, Hirakata Y, Tomonaga M, Sugahara K, Hayashi T, Dateki N, Harasawa H, Nakayama K: Aberrant expression ... MR, Haemel AK, Wood GS: Apoptosis and melanoma: molecular mechanisms J Pathol 2003, 199:275-288 Hasunuma T, Kayagaki N, Asahara H, Motokawa S, Kobata T, Yagita H, Aono H, Sumida T, Okumura K, ... Nakayama J, Ohtsuki M, Kimura T: Antirheumatic effects of humanized anti-Fas monoclonal antibody in human rheumatoid arthritis/SCID mouse chimera J Rheumatol 2002, 29:1609-1614 Ogawa Y, Kuwahara...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt
... Refflat file) and finally to non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and other non-coding RNA (ncRNA) Reads ... RNA was extracted and analyzed at day of differentiation Mature miRNA expression was evaluated using Mirscript assays (Qiagen SA) as specified by the manufacturer’s protocol Real-time PCR was ... G G G G A T C A A G A C A C A T T T G G A G A G G G A A C C T C C C A A C T C G G C C T C T G C C A T C A T T Figure Abundance of each base along the miR-64 2a pre-miR Each experimental condition...
Ngày tải lên: 09/08/2014, 23:20
báo cáo khoa học: " Study of ‘Redhaven’ peach and its white-fleshed mutant suggests a key role of CCD4 carotenoid dioxygenase in carotenoid and norisoprenoid volatile metabolism" ppsx
... The data set was made up of data from eight repetitions of each ripening stage of RH and RHB The variable set was made of the major 41 volatile aroma compounds PCA involves a mathematical procedure ... Plant Physiol 2009, 166:1241-1252 Han SY, Kitahata N, Sekimata K, Saito T, Kobayashi M, Nakashima K, Yamaguchi-Shinozaki K, Shinozaki K, Yoshida S, Asami T: A novel inhibitor of 9-cis-epoxycarotenoid ... with maxima in the range of hundreds of μg/g fresh weight The two genotypes displayed similar ripening-associated patterns for aromatic and branched chain amino acid-, fatty acid-, and furanrelated...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf
... NCOA3-D NR 4A3 -A NR 4A3 -B NR 4A3 -C PCAF -A PCAF-C PDGFRA -A PDGFRA-B PDGFRA-C PKD1 -A PKD2 -A PKD2-B PKD2-C PKD2-D PPARA -A PPARA-B PPARA-C PPARA-D PPARA-E PPARA-F PPARA-H PTEN -A RB1 -A RB1-B RB1CC1 -A ... FOXO 1A- C FOXO 1A- D FOXO 1A- E FOXO 1A- F GAB1 -A HAS2 -A HDAC4 -A HDAC4-B HDAC4-C HDAC4-D HIF1 -A HIF 1A- B IRF1 -A KHDRBS1 -A KHDRBS1-B KPNA2 -A MAP3K8 -A MAP3K8-B MAPK9 -A MYCN -A MYCN-B NCOA3 -A NCOA3-B NCOA3-C ... human oncogene Nature 2005, 435:828-833 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y, Takahashi T: A polycistronic microRNA cluster, miR-17-92,...
Ngày tải lên: 14/08/2014, 20:22
Mobility is a key predictor of change in well being among older adults who experience falls evidence from the vancouver falls prevention clinic cohort
... TLA is a Canada Research Chair in Physical Activity, Mobility, and Cognitive Neuroscience, a Michael Smith Foundation for Health Research (MSFHR) Scholar, a Canadian Institutes of Health Research ... 2B5, Canada of Physical Therapy, 2177 Wesbrook Mall, University of British Columbia, Vancouver, British c Arthritis M AN U Columbia, V6T 2B5, Canada Research Centre of Canada, 5591 No Road, Richmond ... Physiological falls risk was assessed using the short form of the Physiological Profile Assessment (PPA) 156 The PPA is a valid and reliable [60] measure of falls risk Based on a participant’s performance...
Ngày tải lên: 25/08/2016, 22:07
Operations Risk Managing a key Corrponent of Oeperational Risk
... operated in, the financial markets came to terms, as it always does, with what had happened, why it had happened and how it had happened A realisation that operational risk existed, and had always ... and the cause of the failure A regulatory report needs to be prepared Damage limitation and preventative action Operations and process managers must: • • Carry out a review of transaction charges ... risk profile is happening if dynamic and successful risk management is to be achieved By monitoring and analysing the profile of categories and sub-headings, that change as data and management...
Ngày tải lên: 31/03/2017, 09:21
STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING a PROJECT MANAGEMENT
... Responsibility Evaluation of Information Managerial Values of Management Strategy Evaluation Strategy Selection Strategy Implementation FIGURE 2–1 Basic strategic planning Corporate Strategic Plan Strategic ... critical success factors: qualitative factors, organizational factors, and quantitative factors To take advantage of the economic outlook, whatever it happened to be at a given time, senior managers ... project management cannot occur, at least not within a reasonable time frame, without some form of strategic planning for project management Although the principles of strategic planning have been...
Ngày tải lên: 14/08/2013, 13:47
PHÂN TÍCH báo cáo NGHIÊN cứu state owned enterprises (SOEs) in vietnam perceptions of strategic direction for a society in transition
... lãnh đạo vấn, ý định cấu lại doanh nghiệp họ kinh tế cạnh tranh toàn cầu kinh tế Việt Nam ch a hoàn toàn mở c a để doanh nghiệp cạnh tranh cách tự do, bình đảng Thứ hai, tác giả tiếp tục phân tích ... văn mà thay vào mô hình đại h a đề xuất áp dụng cho doanh nghiệp Tác giả ch a đề cập đến hạn chế nghiên cứu gợi mở, gợi ý cho hướng nghiên cứu việc đ a mô hình đại việc đại h a tai Việt Nam Tuy ... ngh a Trong khuôn khổ môn học Phương pháp nghiên cứu khoa học, nhóm phân công phân tích báo cáo nghiên cứu có đề tài "State-owned enterprises (SOEs) in Vietnam - Strategic direction for a society...
Ngày tải lên: 24/12/2013, 23:11
Tài liệu STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING A PROJECT MANAGEMENT MATURITY MODEL ppt
... Responsibility Evaluation of Information Managerial Values of Management Strategy Evaluation Strategy Selection Strategy Implementation FIGURE 2–1 Basic strategic planning Corporate Strategic Plan Strategic ... critical success factors: qualitative factors, organizational factors, and quantitative factors To take advantage of the economic outlook, whatever it happened to be at a given time, senior managers ... project management cannot occur, at least not within a reasonable time frame, without some form of strategic planning for project management Although the principles of strategic planning have been...
Ngày tải lên: 16/01/2014, 16:33
Tài liệu Assessing Financing, Education, Management and Policy Context for Strategic Planning of Human Resources for Health pdf
... profession as a career Can be assessed through internationally-accessible databases or in-country databases • Geographical distribution: salary level Average salary ratio in rural : urban areas, ... (such as capacity for training or financing human resources for health) Rather, a comparison of the actual status of the health workforce as compared to an ideal or, at least, a benchmarked standard, ... are separate associations for physicians, nurses, midwives, pharmacists, dentists and paraprofessionals These associations are often key players interested in salaries, quality of education and...
Ngày tải lên: 14/02/2014, 09:20
Tài liệu STRATEGIC PLANNING–FINANCIAL PERFORMANCE RELATIONSHIPS IN BANKS: A CAUSAL EXAMINATION ppt
... Alden State Bank Alpine Bank American Bank American Fidelity Bank American Heritage Bank American Savings Bank American State Bank Ameritrust Amsouth Bancorporation Arlington State Bank Ashland ... State Bank Auburn State Bank Aurora National Bank Bank of Buffalo Bank of Commerce Bank of the West Bank South Bank One Bankcorp Hawaii Banker’s Trust New York BankFirst Barnett Banks Boatman’s ... ‘The practice and profitability of long-range planning , Managerial Planning, 22, pp 1–7 Gable, M and M T Topol (1987) Planning practices of small-scale retailers’, American Journal of Small Business,...
Ngày tải lên: 16/02/2014, 11:20
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
... TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe 18S TGGACCGGCGCAAGACGGAC ... reverse A B Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ... to Ala was carried out using the QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT...
Ngày tải lên: 19/02/2014, 02:20