a journey from social isolation

... one-size-fits-all approach, as there are chances that the events rather need a human decision to take place This approach can free the user from repetitive tasks, but can also increase maintenance overhead, ... that, applications that are specialized in a particular area may also require batch processing Some of these applications such as PeopleSoft Finance and SAP R/3 had to come with an in-built batch ... scheduling capability and user friendly features, tracking historical job executions and auditing user actions is also available This is because all jobs runs on the same machines are managed from a central...

Ngày tải lên: 24/03/2014, 04:21

... rotating a frame about an axis by an angle will always have the same destination as rotating the original frame about the opposite axis by the negative angle in 3D space The second practical example ... artificial ears and eyes Ten years later, they created a new Wabot-2 as a musician humanoid robot that was able to communicate with a person, read a normal musical score by his eyes and play tones ... a sphere drawing in MATLABT M A diamond and an ellipsoid drawing in MATLABT M Create a rectangular surface in MATLABT M Create a full torus surface in MATLABT M ...

Ngày tải lên: 01/08/2014, 17:42

... 8784–8792 Kawana Y, Kawana K, Yoshikawa H, Taketani Y, Yoshiike K & Kanda T (2001) Human papillomavirus type 16 minor capsid protein L2 N-terminal region containing a common neutralization epitope ... in HPV5 attachment and infection, albeit with apparently different requirements regarding sulfation, because N-desulfated and N-acetylated variants of heparin rather than the highly sulfated form ... unknown, although the availability of activated virions with a reduced affinity to heparan sulfate will potentially allow its identification Initial cell surface interactions are predominantly L1-dependent...

Ngày tải lên: 23/03/2014, 04:20

... PCR: real time reverse transcriptase polymerase chain reaction; RT-PCR: reverse transcriptase polymerase chain reaction Abbreviations AIV: avian influenza virus; HPAI: highly pathogenic avian influenza ... Moreno A, Sala G, Lavazza A, Ghelfi E, Pirovano G, Gasperi E: Avian influenza virus (H7 serotype) in a saker falcon in Italy Vet Rec 2000, 146:740 Page of 17 De Marco MA, Foni E, Campitelli L, Raffini ... samples and from a known AIV (H9N2) isolate using QIAamp viral RNA kit (Qiagen, Valencia, CA) The RNA was tested for AIV in a one-step RT-PCR using primers specific to the matrix gene of AIV [12] Amplified...

Ngày tải lên: 12/08/2014, 04:20

... looked at him blankly Crass (Colin Sass was his real name, though nobody called him that) said nothing to me at all about having a package waiting for this guy ‘Don’t worry, I can come back,’ he said ... what was with that coat anyway? It was almost summer and I was only wearing a T-shirt Everything Robert wore was, in fact, black His tight jeans with the frayed seams, his faded Korn T-shirt and ... on a Saturday afternoon when he knew the coast was clear With Crass gone we could talk in peace Before Topps could even give me a wave a customer walked in wearing plastersplattered overalls and...

Ngày tải lên: 06/11/2012, 16:13

... vùng; đ a phương to separate (v): ngăn cách; tách ra; chia Ex: Their yard is separated from the factory by a tall fence (Sân nhà họ ngăn cách với nhà máy hàng rào cao.) -» separate (adj): riêng ... eighth century (T a nhà trở thành nơi thờ phụng từ kỷ thứ tám.) -> to worship (v): thờ; thờ phụng; tôn thờ ASEAN (abbr) Association of South East Asian Nations: Hiệp hội nước Đông Nam Á Website học ... atmosphere over the party was warm and friendly (Không khí b a tiệc đầm ấm thân mật.) to pray (v): cầu nguyện; cầu khấn Ex: We all prayed that she would soon recover (Tất cầu nguyện cho cô mau...

Ngày tải lên: 17/01/2013, 09:58

... Date of teaching: September 20th, 2006 Period: 06 Activity were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past subjunctive + Ask students to look at the ... subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I lived close to ... d) I wish I drew well + Let students make three wishes of their own Practice Individual Homework - Do exercises / P 12 - Learn by heart the structures Remarks ...

Ngày tải lên: 21/06/2013, 01:27

... The past simple with wish + Give example and explain the way to use Ex : a You are a student ( I wish I were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past ... visited * Cues : - Lang Biang Mountain / blimbing - Xuan Huong Lake / walk around - Valley of Love / sightseeing A : I think I’ll take my friends to ………….We can …… B : Good ideas ! I believe they will ... wish + S + Past subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now b) I wish I had a computer now c) I wish I...

Ngày tải lên: 21/06/2013, 01:27

... Date: Name: _ English 9_ Unit  Fill in each blank with one suitable word: Japan _four main islands Hokkaido, Honshu, Shikoku, and Kyushu A Japanese lunch is a light ... Communist north, and (REUNIFICATE) _occurred in mid-1975  Rewrite these sentences: Lan & her pen-pal, Maryam started corresponding over two years ago Lan & her pen-pal, Maryam have ... Democratic Republic of Vietnam (North Vietnam) and the former Republic of Vietnam (South Vietnam) Education in Vietnam is universal and _ for children ages to 11 The _language of...

Ngày tải lên: 26/06/2013, 01:27

... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... Table - Primers and TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa ... Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake Environ...

Ngày tải lên: 05/09/2013, 10:15

... about Malaysia: Is Malaysia one of the countries of the ASEAN? climate: tropical climate Unit of currency: Riggit 5- Capital city: Kula lumpur Official religion: Islam 7.National language: BahasaM ... introduce a the passage by showing 15 the map and the picture about Malaysia - T asks “What you know about Malaysia - T asks sts to read the passage silently and underline the new words - T explains ... (translation method) - T reads the passage and students listen and find the right information about Malaysia to fill in the table (pair word) - Sts answer (in Vietnamese) - Reading the passage...

Ngày tải lên: 16/09/2013, 13:10

... capital of Malaysia is JakarTa 3-Education is free in Malaysia 4-Malaysia has Twins-towers 5-The currency in Malaysia ia VND III-While-reading Keys: 1-T 2-F 3-F 4-T 5-F Task 1: Fill in the table ... -Set the scene: you are going -listen the situation to read a passage about III-Listen and read Maryams visit to Ha Noi Modal: -Read the passage and ask sts Lan used to walk past the mosque to ... wearing an Ao dai She comes from Viet nam - He is wearing a Kilt The comes from Scotland - She is wearing a Sari She India - He is a Cowboy He the USA - She is a Veil She Saudi Arabia...

Ngày tải lên: 17/09/2013, 03:10

... taking part in building the new lesson Lan – Maryam *Who are they ? *Where is Maryam from? *Lan and Maryam *Malaysia “Maryam is Lan’s pen pal from Malaysia It’s the first time Maryam visited Hanoi” ... (Nga) Who is Nga ? (Lan’s friends) What are they doing ? (waiting for Lan) Nga – Maryam *Nga and Maryam *Who are they ? “This is the time Nga and Maryam meet each other They are talking to each ... they ? What is the population of Malaysia in 2001 ? What is the area of Malaysia ? How many languages primary school students learn at school ? IV Post READING: - Fill in the table with the...

Ngày tải lên: 19/09/2013, 02:10

... (see also Adams, 1964) 46 What is the Nature of Social Phobia? The Measurement of Social Anxiety As we have seen earlier, a variety of meanings are attached to the term anxiety (and fear) This ... the social domain (social anxiety) and social phobia in particular Consequently, as concepts cannot meaningfully be used divorced from the way they are measured (and vice versa), I shall examine ... configurations of any pattern are limited both by what society 44 What is the Nature of Social Phobia? (and particularly the family) dictates and by which basic emotions are developmentally available’’...

Ngày tải lên: 01/11/2013, 08:20

... schema from the data, and loads the data into the DataSet The DataSet schema is extended by adding new tables and columns as required ReadSchema Reads any inline schema and loads the data into ... settings: Auto • • • DiffGram if the data is a DiffGram ReadSchema if the DataSet already has a schema or the XML document contains an inline schema InferSchema if the DataSet does not already have a ... schema and the XML document does not contain an inline schema Auto is the default DiffGram Reads a DiffGram applying the changes to the DataSet The target DataSet must have the same schema as the...

Ngày tải lên: 24/12/2013, 05:15

... LinkedIn users are able to follow conversations using hashtags and for B2B connections, they work Does using a number really make a dif f erence? Conventional wisdom says social media posts (and blog ... days Best hours of t he day Twit t er: Between 10 a. m and noon After about p.m there is a significant drop, probably because many people check their Twitter stream after they settle in and are ... B2C companies, messages on Twitter receive 82% fewer clicks if they include a hashtag, but hashtagged messages are 193% more effective for B2B B2B followers appreciate relevant hashtags; B2C...

Ngày tải lên: 06/02/2014, 17:14

... for a particular nutrient Statistical Analysis All anthropometric measurements were made in duplicate and the means of paired values were used in the analyses The data were statistically analyzed ... Pakhtunkhwa (Previously: NWFP), 25000, Pakistan Authors’ contributions IA and GP designed research; IA, and PIP conducted research and collected the data; IA and AL analyzed the data; IA wrote the manuscript; ... provided by NADRA Data Collection Data were collected by the first author assisted by trained graduate students of the Department of Human Nutrition, Agricultural University, Peshawar Age and Anthropometric...

Ngày tải lên: 14/02/2014, 06:20

... radiotherapy in management of cancer pain Pain Cause Bone pain Metastases Pathological fracture (non-surgical e.g rib / pelvis) Headache Primary cerebral tumour Brain metastases Abdominal pain ... Moscol A, Zaharia M, Zaman S, Perez Escutia MA Fractionated half3 body irradiation (HBI) for the rapid palliation of widespread, symptomatic metastatic bone disease: a randomised phase III trial ... be associated with a transient flare-up of pain that needs to be managed with the appropriate manipulation of analgesia 4.2.2 Thoracic pain • The common causes of intra-thoracic pain in malignancy...

Ngày tải lên: 14/02/2014, 21:20

... combinations; he was far away from earth, and really far away from earthly wants About noon hunger began to stimulate me severely Martha had, without thinking any harm, cleared out the larder the night ... was there; so I said nothing, and could eat nothing At half-past five there was a rattle of wheels outside A large carriage was there to take us to the Altona railway station It was soon piled up ... niedrke kt,samn atrateS saodrrn emtnaeI nvaect rrilSa Atsaar nvcrc ieaabs ccrmi eevtVl frAntv dt,iac oseibo KediiI When this work was ended my uncle tore the paper from me and examined it attentively...

Ngày tải lên: 17/02/2014, 04:20