... users is the acquisition of detailed data sources that contain locational and attribute information on the built environment Spatial data can be acquired using primary or secondary data collection ... primary data these, and other secondary data sources, may be relatively cost-effective to obtain and can usually be sourced for specific study areas or across a large geographical area (e.g nationwide) ... be replicated by other researchers A key drawback of secondary data sources is that they are often not designed for the analytical purposes for which they are being used and therefore may not entirely...
Ngày tải lên: 14/08/2014, 08:20
... planning California has been the site of a great deal of action and innovation in these arenas There are several markers of such activity in the state: (1) the proliferation of exchanges among professionals ... as Fontana was initially part of a Spanish land grant Located in the Inland Empire, Fontana began as a small agricultural town in 1913 The Kaiser Steel mill opened in the area in 1942 Fontana ... Impacts of the Built Environment on Health: The State of the Art 19 BARHII and its Collaboration with Urban and Regional Planners The Bay Area Regional Health Inequities Initiative (BARHII) is a regional...
Ngày tải lên: 28/06/2014, 21:20
Báo cáo y học: "Outcome of crisis intervention for borderline personality disorder and post traumatic stress disorder: a model for modification of the mechanism of disorder in complex post traumatic syndromes" ppsx
... guidance from the research staff about the criteria for each rating The nurses' judgment was based on review of the medical record, as a summary of all staff accounts Although the nurses assigned ... patients mislearn from their private experiments faster than they make progress in therapy with analysis of the transference and of scenarios of old betrayals The crisis intervention of the Cape ... to psychotherapy that, in turn, may repair the mechanism of crises, thereby making medication unnecessary Some authors explain the limitations of pharmacotherapy by the nature of BPD and complex...
Ngày tải lên: 08/08/2014, 23:21
Creating an Inclusive Environment: A Handbook for the Inclusion of People with Disabilities in National and Community Service Programs ppt
... tử ba minh h a ví dụ sau Sử dụng toán tử bao using System; class Tester { public static int Main() { int value1; int value2; int maxValue; value1 = 10; value2 = 20; maxValue = value1 > value2 ... foreach Câu lệnh lặp foreach với người học ngôn ngữ C, từ kh a sử dụng ngôn ngữ Visual Basic Câu lệnh foreach cho phép lặp qua tất mục mảng hay tập hợp Cú pháp sử dụng lệnh lặp foreach sau: foreach ... b Công thức khai báo mảng Datatype [] variableName = new Datatype [number of elements]; Trong đó: number of elements: số phần tử mảng Datatype: kiểu liệu mà mảng lưu trữ variableName: tên mảng...
Ngày tải lên: 28/06/2014, 23:20
Teach english, teach about the environment a resource for teachers of adult english for speakers of other languages (ESOL)
... the Beginning, Intermediate and Advanced levels The backs of the Flash Facts are blank Teachers may use this area to translate the facts into the native language(s) of the student(s) or for additional ... away items rather than throwing these items into the waste stream For a large number of unwanted items, students can hold a garage sale They can also be encouraged to shop at garage sales before ... sense of the amount of garbage generated by each student Chart on board Compare to Flash Fact #1 Teach English, Teach About the Environment A Resource for Teachers of Adult English for Speakers of...
Ngày tải lên: 27/05/2014, 07:45
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... calculation of k+ We have tested the application of the uorescent analogue CBC as a tool for investigation of the binding kinetics of nonuorescent ligands Cyano-cobalamin (CNCbl) was examined in the ... indicated at least a 10-fold faster liberation of the uorescent analogue when compared with Cbl The CBC dissociation spanned at least 90% of the total amplitude, which allows one to describe the ... transition in the absorbance spectra of the protein-associated ligands IFH2OCbl IFCNCbl As seen from the data in Fig 5C, stability of both IF30CblIF20 and IF30CBCIF20 was lower than that of the...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu English Style Guide A handbook for authors and translators in the European Commission pptx
... Geneva (for Lac Léman), Lake Maggiore (for Lago Maggiore) and Lake Balaton (for Balaton) 2.42 Strait/straits The singular is the form commonly used in official names, for example: Strait of Dover ... Maghreb and Mashreq The article Al and variants should be capitalised at the beginning of names but not internally: Dhu al Faqar, Abd ar Rahman Do not use hyphens to connect parts of a name 6.9 ... Countries/cities Watch out for the definite article when translating place names from French, as in the following table Country/territory City/town (au) Gaza — the Gaza Strip (à) Gaza — Gaza (au) Guatemala —...
Ngày tải lên: 24/02/2014, 18:20
The pollution of the marine environment by plastic debris: a review pptx
... Atlantic NW Mediterranean French Mediterranean Coast European coasts Caribbean coast of Panama Georgia, USA Mediterranean beaches 50 South African beaches 88 sites in Tasmania Argentina Sub-Antarctic ... Sub-Antarctic Islands South Australia Kodiak Is, Alaska Tokyo Bay, Japan North Pacific Ocean Mexico Transkei, South Africa National Parks in USA Mediterranean Sea Cape Cod, USA North Atlantic harbors, ... Beach Beach Beach Beach Seabed Seabed Surface waters Beach Beach Beach Surface waters Beach/harbour Harbour Beach Beach Beach Beach Beach Beach Beach Seabed Beach Beach Beach Beach 59 51 36 40/64...
Ngày tải lên: 06/03/2014, 23:20
Báo cáo Y học: Identification of residues critical for activity of the wound-induced leucine aminopeptidase (LAP-A) of tomato pptx
... GGCTACAACCTCNNNGTCGGAGCTCGT 3¢ Zn-binding E334 E354 E429 5¢ CAATACTGATGCTNNNGGTAGGCTCACA 3¢ R431 5¢ CAATACTGATGCTGACGGTAGGCTCACA 3¢ 5¢ CAATACTGATGCTAGCGGTAGGCTCACA 3¢ 5¢ TGATGCTGAGGGTNNNCTCACACTTGC ... designations for the blLAP (Table 1, [22,24]); the tomato LAP -A1 residues studied appear in parentheses A model of the reactive site of the tomato LAP based on the bovine LAP and E coli PepA appears in ... gem-diolate transition state The Ala substitution mutant (K35 4A) of the tomato His6–LAP -A was not evaluated in the tomato LAP -A1 series of mutations The tomato residues Glu429 and Asp347 residues may...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo khoa học: TioS T-TE – a prototypical thioesterase responsible for cyclodimerization of the quinoline- and quinoxaline-type class of chromodepsipeptides potx
... obtained with TL4, the analogous substrate TL10 was synthesized HPLC-MS analysis revealed the formation of the macrocycle Cy10 at a hydrolysis to cyclization ratio of : Additionally, the formation ... iterative ligation and macrocyclization platform that is capable of catalyzing macrolactonization and a so far unreported macrothiolactonization Initially, TioS T-TE was tested using a linear ... To evaluate the DNA-bisintercalation activity assay To evaluate the DNA-bisintercalative properties of chemoenzymatically generated thiocoraline analogs and to elucidate structural features contributing...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo Y học: A model for recognition of polychlorinated dibenzo-p-dioxins by the aryl hydrocarbon receptor docx
... ortholog of Caenorhabditis elegans (AhR-1C.E.), neither photoaf®nity labeled by a dioxin analog, nor activated by b-naphto¯avone in a yeast system [20]; the rainbow trout AhRa that binds TCDD [21] and ... to the bound state, Arg206 affects the position of Asp212, which in turn undergoes the largest conformational change of all the sidechains [12] Interestingly, although the conformation of the ... of the isolated domain PYP has been previously proposed as an appropriate structural template for AhR, but our analysis of the recently determined structures of the FixL and the HERG PAS domains...
Ngày tải lên: 24/03/2014, 00:21
A Handbook for the Mechanical Designer ppt
... tabular data The performance curve also is a valuable tool when evaluating fan performance in the field Fan performance tables and curves are based on standard air density of 0.075 lb/ft3 When altitude ... engine with afterburner Jet aircraft at takeoff Turboprop at takeoff Prop aircraft at takeoff Loud rock band Small aircraft engine Blaring radio Car at highway speed Axial ventilating fan (2500 ... shall be made of nonferrous material Steps must also be taken to assure that the impeller, bearings, and shaft are adequately attached and/or restrained to prevent a lateral or axial shift in these...
Ngày tải lên: 01/04/2014, 00:20
jack, k. (2001). video demystified - a handbook for the digital engineer (3rd ed.)
... used for broadcast purposes) It is a set of two analog signals, one analog Y and one that carries the analog U and V information in a specific format (also called C or chroma) Once available ... has a range of 0–255, I has a range of to ±152, and Q has a range of to ±134 I and Q are obtained by rotating the U and V axes 33° These equations are usually scaled to simplify the implementation ... -4 = = = = = 21 SAMPLE SAMPLE SAMPLE SAMPLE SAMPLE 16 BITS PER SAMPLE DATA DATA DATA DATA DATA Figure 3.4 4:2:2 Frame Buffer Formatting SAMPLE SAMPLE SAMPLE SAMPLE SAMPLE SAMPLE ACTIVE LINE NUMBER...
Ngày tải lên: 18/04/2014, 12:27
paths to a green world the political economy of the global environment
... work and far-reaching talents Sharon Goad, Joshua Gordon, Jeca Glor-Bell, and Sanushka Mudaliar also helped immeasurably with the research We are grateful to the Australian Research Council and the ... Protection Act (U.S.) NAAEC North American Agreement on Environmental Cooperation NAFTA North American Free Trade Agreement NASA National Aeronautics and Space Administration NGO Nongovernmental organization ... societal debates about environment and political economy rather than just the academic debates over the theories of the political economy of the environment Naturally, given the breadth of our labels,...
Ngày tải lên: 01/06/2014, 10:55
making sense of online learning a guide for beginners and the truly skeptical
... and retrain people mean the need to teach and learn at a distance will escalate Some of the main benefits of online learning (a form of distance learning) are flexibility (people can learn at any ... study, for example—were text-based because books and paper were the technology that was available at the time As technologies change and expand, the options for learning expand with them Because the ... movie camera Over time, they realized that movies didn’t have to follow the same rules as stage plays They began optimizing the best characteristics of the new medium for example, the fact that you...
Ngày tải lên: 03/06/2014, 02:04
a place for consciousness probing the deep structure of the natural world nov 2004
... of Causation,” to a direct analysis of causation and the conditions on the possibility of causal interaction As a first point, I build a case that the explanation of causation also requires nature ... present a fair overview of them The argument against physicalism is an argument against the claim that the physical facts entail the facts about phenomenal consciousness The form of the argument ... Panexperientialism On the Probability of Panexperientialism Paradoxes for Liberal Naturalism II 13 91 104 114 FACES OF CAUSATION Against Hume The Theory of Causal Significance 129 141 10 A Tutorial on Causal...
Ngày tải lên: 11/06/2014, 10:40
the mit press paths to a green world the political economy of the global environment apr 2005
... work and far-reaching talents Sharon Goad, Joshua Gordon, Jeca Glor-Bell, and Sanushka Mudaliar also helped immeasurably with the research We are grateful to the Australian Research Council and the ... Protection Act (U.S.) NAAEC North American Agreement on Environmental Cooperation NAFTA North American Free Trade Agreement NASA National Aeronautics and Space Administration NGO Nongovernmental organization ... societal debates about environment and political economy rather than just the academic debates over the theories of the political economy of the environment Naturally, given the breadth of our labels,...
Ngày tải lên: 11/06/2014, 12:44
Báo cáo hóa học: " The Reflux Disease Questionnaire: a measure for assessment of treatment response in clinical trials" pdf
... of the translated RDQ High levels of internal consistency across the translated RDQ scales would be evidence of the amenability to translation Analysis revealed that, regardless of language, all ... structured by the trial case record form for each visit and graded = none, = mild, = moderate, and = severe Translation and cultural adaptation The RDQ was translated into Norwegian and Swedish according ... preferably selfadministered The multicenter, multinational nature of pharmaceutical clinical trials also requires questionnaires that are amenable to translation into multiple languages The Reflux...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" A comprehensive systematic review of the development process of 104 patient-reported outcomes (PROs) for physical activity in chronically ill and elderly people" pptx
... and adaptation 1.9% Adaptation and literature (systematic search) 1% Adaptation and experts 1% Patients and adaptation and literature (unsystematic search) 1% Patients and experts and adaptation ... Ronen Igakkai Zasshi - Japanese Journal of Geriatrics 2005, 42(2):229-234 12 Inaba Y, Obuchi S, Oka K, Arai T, Nagasawa H, Shiba Y, Kojima M: [Development of a rating scale for self-efficacy of physical ... Lurie A, Bean K, Mesbah M, Venot A, Strauch G, Grandordy BM, Chwalow J: The Asthma Impact Record (AIR) index: a rating scale to evaluate the quality of life of asthmatic patients in France European...
Ngày tải lên: 20/06/2014, 15:20