A Call from the Dark
... have a 6 Robert’s heavy, knee length black coat clung to him tight, like cling film. It was about two sizes too small. And what was with that coat anyway? It was almost summer and I was ... nobody called him that) said nothing to me at all about having a package waiting for this guy. ‘Don’t worry, I can come back,’ he said when he realised I didn’t know what he was talking about. ... wonder why I don’t have one. In fact we don’t have any pets at all. They’ve all gone and died, including a couple of cats, a goldfish and a white rabbit called Snow that Mum and Dad bought me for...
Ngày tải lên: 06/11/2012, 16:13
... South East Asian Nations: Hiệp hội các nước Đông Nam Á Website học trực tuyến – www.videobook.vn official (adj): chính thức Ex: There will be an official investigation into last week’s accident. ... www.videobook.vn Ex: The atmosphere over the party was warm and friendly. (Không khí b a tiệc rất đầm ấm và thân mật.) to pray (v): cầu nguyện; cầu khấn Ex: We all prayed that she would soon recover. ... building has been a place of worship since the eighth century. (T a nhà này đã trở thành nơi thờ phụng từ thế kỷ thứ tám.) -> to worship (v): thờ; thờ phụng; tôn thờ ASEAN (abbr) Association...
Ngày tải lên: 17/01/2013, 09:58
... students will be able to use past simple, and past simple with wish II. Language contents: 1. Grammar : 2. Vocabulary : III. Techniques : Eliciting questions, asks and answers IV. Teaching aids : Textbook, ... ask and answer questions about what Ba, Nga, Lan, Nam and Hoa did on the weekend ( exercis1/ P 11) +Tell them that the activities happened in definite in the past. + Let students practice in ... conversation between Tan and Phong. They are talking about Ba did on the weekend. + Give the model Form : VERB + ED or PAST FORM OF IRREGULAR VERB ( V2 ) +Ask students to work in pairs to ask and...
Ngày tải lên: 21/06/2013, 01:27
Unit 1: A visit from a pen pal
... in it. The past simple with wish + Give example and explain the way to use Ex : a. You are a student ( I wish I were a teacher ) b. You live in a bike. ( I wish I lived in a car ) Form : ... visited. * Cues : - Lang Biang Mountain / blimbing - Xuan Huong Lake / walk around - Valley of Love / sightseeing A : I think I’ll take my friends to ………….We can …… B : Good ideas ! I believe they ... : I wish + S + Past subjunctive + Ask students to look at the real situations and make wishes • Sample answers : a) I wish I were in the swimming pool now . b) I wish I had a computer now...
Ngày tải lên: 21/06/2013, 01:27
Unit 1_ A visit from a penpal
... 1. Lan met her Malaysian pen pal, Razali Maryam last week. Listen and check the places they visited. Answer these Qs. Created by TTM_titiempi Malaysia Viet Nam Area Population Capital city Climate Unit ... city Climate Unit of currency Official religion ( & others ) National language Compulsory second language Unit 1: a visit from a pen pal Imagine a foreign pen pal is coming to stay with ... word: 1. Japan _________________four main islands Hokkaido, Honshu, Shikoku, and Kyushu . 2. A Japanese lunch is a light meal and may _________________ of tsukemono, salted fish, and tsukudani, seafood...
Ngày tải lên: 26/06/2013, 01:27
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
Ngày tải lên: 05/09/2013, 10:15
unit 1: A visit from a penpal- t3,t4
... Tim and Carol are and that they are doing. - Listening and choosing the correct answers. - Comparing their answers with the partner’s. * key: a- 1 b-2 c-2 where Tim and Carol are and that they ... questions. 2-Vocabulary: Some words relating to capitals and big cities in the word, especially in Asia. II. Preparation: Pictures, cassette player and tape. III. Procedures: 1- organization: goodmorning! Who ... them. 3- Post - reading: Speaking T gives some questions about Malaysia: 1. Is Malaysia one of the countries of the ASEAN? 2. How many regions are there? 3. Is Kuala Lumpur the largest city in...
Ngày tải lên: 16/09/2013, 13:10
unit1: A visit from a pen pal
... Viet Nam 2-The capital of Malaysia is JakarTa 3-Education is free in Malaysia. 4-Malaysia has Twins-towers 5-The currency in Malaysia ia VND III-While-reading Keys: 1-T 2-F 3-F 4-T 5-F Task 1: ... the table. 1-area: 329,758 sq km 2-population: 22 triệu ngời 3-climate: tropical 4-Unit of currency: Ringit 5-Capital city: Kuala Lumpur 6-Official religon: Islam 7-National language: Bahasa 8-Compulsory: ... months last year. 3. _______ my way_______school this morning, I saw a car accident VI. Listen carefully and complete the sentences (1pt) 1. Canada is the second largest country…… 2. The Capital...
Ngày tải lên: 17/09/2013, 03:10
A VISIT FROM PEN PAL
... tropical climate 4 . ringgit 5 . Kuala Lumpur 6 . Bahasa Malaysia 7 . English V . HOMEWORK: - Write some information to describe Malaysia in the notebooks Ex : Malaysia is a member of ASEAN ... task: 1 .T 2 . F 3 . F 4 . F 5 . F 2.Questions: 1 . How many regions are there in Malaysia ? What are they ? 2 . What is the population of Malaysia in 2001 ? 3 . What is the area of Malaysia ... the poster - Asking Ss to ask and answer about Ba , Lan , Nam and Hoa - Taking part in the activities in groups ( Red and White ) - Listening and repeating after the teacher about the words...
Ngày tải lên: 19/09/2013, 02:10
Tài liệu Saving and Loading a DataSet from XML pptx
... tables. The XML schema and data for the DataSet is written both to a file and to a text box on the form. Read Button.Click Creates a DataSet and reads in schema and data from a file containing ... Team LiB ] Recipe 8.2 Saving and Loading a DataSet from XML Problem You need to save a DataSet as an XML file and create a DataSet from an XML file. Solution Use the XmlTextWriter and ... DataTable orderTable = new DataTable(ORDERS_TABLE); da.FillSchema(orderTable, SchemaType.Source); da.Fill(orderTable); ds.Tables.Add(orderTable); // Fill the OrderDetails table and add...
Ngày tải lên: 24/12/2013, 05:15
Tài liệu Relationship between anthropometric variables and nutrient intake in apparently healthy male elderly individuals: A study from Pakistan docx
... RESEARCH Open Access Relationship between anthropometric variables and nutrient intake in apparently healthy male elderly individuals: A study from Pakistan Iftikhar Alam 1,2* , Anis Larbi 3 , ... Khyber Pakhtunkhwa (Previously: NWFP), 25000, Pakistan. Authors’ contributions IA and GP designed research; IA, and PIP conducted research and collected the data; IA and AL analyzed the data; IA wrote the manuscript; ... 16:289-98. doi:10.1186/1475-2891-10-111 Cite this article as: Alam et al.: Relationship between anthropometric variables and nutrient intake in apparently healthy male elderly individuals: A study from Pakistan. Nutrition Journal 2011...
Ngày tải lên: 14/02/2014, 06:20
Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx
... Mouelle-Sone A, Moscol A, Zaharia M, Zaman S, Perez Escutia MA. Fractionated half3 body irradiation (HBI) for the rapid palliation of widespread, symptomatic metastatic bone disease: a randomised phase ... and chemotherapy can have a major palliative role. 4.1.4 Hormone therapy Breast and prostrate cancer account for a large number of patients who present with metastatic disease and cancer pain ... headache may also be due to anxiety and depression and that other common, non-malignant causes of headache may be found in patients with advanced cancer, such as tension headache and migraine....
Ngày tải lên: 14/02/2014, 21:20
Tài liệu Báo cáo khoa học: Aldehydes release zinc from proteins. A pathway from oxidative stress⁄lipid peroxidation to cellular functions of zinc pptx
... effects of etha- nol and treatment with disulfiram. Alcohol Alcohol 28, 461–468. 30 Isse T, Oyama T, Kitagawa K, Matsuno K, Matsumoto A, Yoshida A, Nakayama K, Nakayama K & Kawa- moto T (2002) ... Gasso M, Rubio M, Caballeria J, Pares A, Rodes J & Fernandez-Checa JC (2000) Enhanced DNA binding and activation of tran- scription factors NF-kappa B and AP-1 by acetaldehyde in HEPG2 cells. ... chem- istry-generated free radicals [27]. In diabetes, there are pathways for the increased formation of a- keto- aldehydes such as glyoxal and methylglyoxal from glyceraldehyde 3-phosphate. Autoxidation of a- hydroxy- aldehydes...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... senses across dictionaries, hence Wik is only used as augmented data for WMF to better learn the semantics of words. All data is tokenized, POS tagged (Toutanova et al., 2003) and lemmatized, ... our disambiguation algorithm. It is a graph- based algorithm, where nodes are senses, and edge weight equals to the sense pair similarity. The final answer is chosen as the sense with maximum ... (adjectives and adverbs) do not have a taxonomic representation structure. For example, the jcn similarity measure (Jiang and Conrath, 1997) computes the sense pair similarity score based on the information...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt
... CTGATCTAGAGGTACCGGATCC 5RACF ATCCTCACGAACAAGCAG 5RACR GATCGCGATGCAGGCCTT FLF1 GGACGACTACAGCGTCTTCAGTAGA FLR1 TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis discus hannai. ... The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A putative signal peptide is indicated by a dotted underline. The amino-acid sequences ... (OH, USA), TOYOPEARL CM-650 M was fromToyo Soda Mfg, Co. (Tokyo, Japan), Sephacryl S-200 HR was from Amer- sham Pharmacia Biotech AAB (NJ, USA), and Hydroxy- apatite (Fast Flow Type) was from Wako...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt
Ngày tải lên: 21/02/2014, 00:20
Tài liệu The Days of Bruce Vol 1 A Story from Scottish History ppt
Ngày tải lên: 22/02/2014, 03:20
Bạn có muốn tìm thêm với từ khóa: