a general workflow for the analysis of heteroplasmy

... SO performed data analysis PH did statistical analysis INL, DA and SD did auxiliary experimental work and interpretation of data DS supplied material MLB and TS supplied auxiliary data and contributed ... microarrays and EMSA-Seq (Table 3) The canonical AGGAA ATTCCG sequence was bound by the RELA homodimer in all assays Interestingly, all three non-canonical sequences, AGGGGGATCTG, AGGGAAGTTA and ... database This database was accessed and available content downloaded on 15 November 2010 All 3407 TASs in the database were mapped to the nearest BRS and ordered according to distance of the TAS...

Ngày tải lên: 09/08/2014, 23:20

... 1) A series of b-chain variants was created, including R6 0A/ R10 1A, D6 6A, L10 5A, F11 4A/ I11 6A and H10 8A These changes were based on the theoretical analysis and were expected to be structurally ... after measurement of absorbance at 280 nm and dialyzed against NaCl/Tris pH 8.0 (50 mM Tris/HCl, 150 mM NaCl) Following dialysis, the absorbance was again measured and the concentration of antibody ... 3B,C and Table 1) The apparent slightly lower efficiency of the F11 4A/ I11 6A variant (around threefold) to compete for protein S binding was not statistically significant The results of the assay are...

Ngày tải lên: 17/03/2014, 09:20

... Japan) for quantitation Helicase assay The substrate for helicase assay was prepared by annealing a 29 mer oligo (5¢-CCAAAACCCAGTCACGACGTTGT AAAACG-3¢) to M13mp18 single-stranded circular DNA ... 2008 The Authors Journal compilation ª 2008 FEBS A Sharma et al staining was obtained) that are the manifestation of active replication forks in these bacteria (Fig 4A, B, upper panels) HpDnaB and ... has an affinity towards HpDnaB that allows their coprecipitation Association of HpDnaB and HpSSB at high salt concentration indicates that these two proteins may have an affinity towards each other...

Ngày tải lên: 30/03/2014, 02:20

... progression of adult T-cell leukemia Leuk Res 1999, 23:311-316 Kubuki Y, Suzuki M, Sasaki H, Toyama T, Yamashita K, Maeda K, Ido A, Matsuoka H, Okayama A, Nakanishi T, et al.: Telomerase activity and ... 5'CCGCTGCCTTCATTAGAAAG-3', TRF2 sense, 5'-GACCTTCCAGCAGAAGATGC-3' and antisense, 5'-GTTGGAGGATTCCGTAGCTG-3' The thermal cycling conditions consisted of 40 cycles at 95°C for 10 sec, 61°C for sec, 72°C for ... 5'-TGTTTCTGGATTTGCAGGTG-3' and antisense, 5'-GTTCTTGGCTTTCAGGATGG-3', Pot1 sense, 5'TGGGTATTGTACCCCTCCAA-3' and antisense, 5'-GATGAAGCATTCCAACCACGG-3' TRF1 sense,5'-GCTGTTTGTATGGAAAATGGC-3' and antisense: 5'CCGCTGCCTTCATTAGAAAG-3',...

Ngày tải lên: 13/08/2014, 09:21

... Be first to know when grammar rules change! Sign up to our newsletter here: englishgrammar.org (It's free) Powered by TCPDF (www.tcpdf.org) ...

Ngày tải lên: 17/07/2015, 20:31

... 3Â-TTTTCACACTGTACCTTATTTAATCA-5Â; ICAP (28 bp), 5Â-AATTAATGTGACATATGTCACAT TAATT-3Â and 3Â-TTAATTACACTGTATACAGTGTAAT TAA-5Â The recognition half-sites are shown in bold An equimolar amount of complementary ... sequences of duplexes used in this study were as follows: lac (26 bp), 5Â-ATTAATGTGAGTTAGCTCACTCATT A- 3Â and 3Â-TAATTACACTCAATCGAGTGAGTAAT-5Â; gal (26 bp), 5Â-AAAAGTGTGACATGGAATAAATT AGT-3Â and 3Â-TTTTCACACTGTACCTTATTTAATCA-5Â; ... donor and the acceptor To approximate the distance between the Trp85Cys178 pair, we assumed that the Forster distance ă for the tryptophanIAEDANS pair was 22 A [26,27] The estimated distances are...

Ngày tải lên: 20/02/2014, 23:20

... Graphical representation of the relative densities of the free DNA measured at increasing concentrations of HbpR The percentage of free DNA was calculated from densitometric measurements of the ... Tropel and J R van der Meer A B Fig (A) Genetic organization of the hbp genes in Pseudomonas azelaica strain HBP1 Open and grey bars (some as arrows) depict the orientation and the size of the genes; ... radiolabeled bands as the density of the remaining unbound operator fragment at any HbpR concentration divided by that without HbpR (first lane of each panel) The dashed arrow points to the graphical...

Ngày tải lên: 07/03/2014, 17:20

... 5¢-CACCCTTGCGCTCTCTCA 3¢-GTGGGAACGCGAGAGAGT + 5¢-CACCCTTX CGCTCTCTCA 3¢-GTGGGAAC GCGAGAGAGT + 5¢-CACCCTTGCX CTCTCTCA 3¢-GTGGGAACGC GAGAGAGT 5¢-CACCCTTGCGCTCTCTCA 3¢-GTGGGAACGMGAGAGAGT + 5¢-CACCCTTX ... 5¢-TGAGAGAGCGCAAGGGTG 5¢-TGAGAGAGMGCAAGGGTG 5¢-CACCCTTX+CGCTCTCTCA 5¢-CACCCTTGCX+CTCTCTCA 5¢-GAGCCAAY+CGCACTCTGA 5¢-GAGCCAAGCY+CACTCTGA with the effects of the minor-groove (+)-trans-B [a] P-N2-dG adduct ... within the catalytic domain of the M.HhaI with the DNA minor groove play an important role in the methylation reaction The contacts of the M.HhaI small domain with the DNA major groove are responsible...

Ngày tải lên: 19/02/2014, 00:20

... sequence-specific DNA binding to DNA treatment with cisplatin and the ability of the particular p53 target site to accommodate the cisplatin IACs The higher the probability of formation of the cisplatin IACs ... 474 base pair fragment of the pPGM4 plasmid (not shown), in contrast to the behavior of the analogous pPGM1 fragment [31] These data revealed a clear correlation between the sensitivity of the ... observed for the unmodified targets in the absence of the competitor fragments (first samples of each set) were taken as For other details, see Figs and of the particular p53DBS The frequency of DNA modification...

Ngày tải lên: 19/02/2014, 05:20

... understanding the reaction mechanism and the regulation of homologous recombination So far, the crystal structures of bacterial RecA, archaeal Rad51 (RadA), yeast Rad51 (ScRad51), human Rad51 (HsRad51), ... RadA (MvRadA), Saccharomyces cerevisiae Rad51 (ScRad51), and Escherichia coli RecA (EcRecA) domains The N-terminal domains, the conserved ATPase domains, and the C-terminal domain are indicated ... Nature 420, 287–293 Kinebuchi T, Kagawa W, Enomoto R, Tanaka K, Miyagawa K, Shibata T, Kurumizaka H & Yokoyama S (2004) Structural basis for octameric ring formation and DNA interaction of the...

Ngày tải lên: 19/02/2014, 06:20

... 5'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCA GTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGT * O1 cl * * –80 O2 O2 –70 –60 –50 –40 –30 O1 O2 * ACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTAT TGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATA ... DNAs Synthesis of O DNA Synthesis of O1DNA pHC2 GAATTCTTGGTTCTATAGTATCTG PCR11 GACTCAAGTACACGTATCGTGTATA GTAGGTTTA PCR21 AAACCTACTATACACGATACGTGTA CTTGAGTCA IIa ATTCAACAAAAAAATACACGAAAAG CAAACTTTTATGTTGACTCAAGTA ... CAAACTTTTATGTTGACTCAAGTA IIb TACTTGAGTCAACATAAAAGTTTGC TTTTCGTGTATTTTTTTGTTGAAT PCI51 GAATTCTCGCTAATTCTTTTTTATC IIId TTTTTTTGTTGAATACCAAAAATAA TTGGGTTATACTATAG CSP4 CATGCCATGGATGAATAACGGTACAG CSP6...

Ngày tải lên: 07/03/2014, 00:20

... CATGAAGCTTGCATGGCCGGGGCC (located upstream of furS) CGAGAATTCGAAAACGAACGGTGC (located upstream of furS and ending at the 5¢-end of binding site I) GTTGAATTCTCGTGTTTATGAGGG (located upstream of ... furS and beginning at the 3¢-end of binding site I) GGAGCTGCAGCCCACGCGATCGCG (located downstream of the start codon of furS) GGTAAGCTTCTCCAGGGTCAGATG (located upstream of hbpS) GCCGAATTCTCCTCAGCATGTCCAG ... Biolabs (Frankfurt am Main, Germany), Roche (Mannheim, Germany), or Promega (Mannheim, Germany) Isolation of DNA and transformations Plasmids were isolated from E coli with the aid of a mini plasmid...

Ngày tải lên: 07/03/2014, 10:20

... Gutkind for plasmids, Ms S Okamura, Ms K Shin-Fukuhara, Ms M Yonemitsu, and Dr M Nakagawa for technical assistance, Dr H Saya and Dr T Hirota for advice and discussion on the phosphorylation analysis, ... coexpression of E47 significantly enhanced the activity of dHAND-WT, -Ala-X, or -Ala (Fig 6A and data not shown) It was of interest that coexpression of Akt reduced the transcriptional activity of dHAND-WT/E47 ... The activity of dHAND-Ala-X/E47 was partially reduced by coexpression of Akt But this inhibitory effect of Akt was not detected in the case of dHAND-Ala/E47 (Fig 6A) Luciferase assay was performed...

Ngày tải lên: 07/03/2014, 16:20

... yielded a major termination downstream of AAUAAA signal at the end of CAA*, A being the terminal nucleotide 16 295 of the mouse mt genome (189 nt transcript; Fig 7A and C, lane 4) An additional major ... that of the D-TERM DNA The D-TERM DNA contains the cononical polyadenylation signal sequence AATAAA Further, 20 and 50 molar excesses of Mut1 DNA, with nucleotide replacements targeted to the AATAAA ... double-stranded DNA ) termed D-TERM DNA ) contains the promoterdistal termination sequence of the mouse mt genome immediately upstream of tRNAPhe (16274-5¢-ATTACG CAATAAACATTAACAA-3¢-16295) About...

Ngày tải lên: 08/03/2014, 08:20

... Kitabayashi, A. N., Arai, T., Kubo, T & Natori, S (1998) Molecular cloning of cDNA for p10, a novel protein that increases in the regenerating legs of Periplaneta americana (American cockroach) ... pattern of phk-2 (A, B) phk-2-GFP transgenic larvae exhibit green fluorescence in the ganglia of the antenno-maxillary organ (A, arrow), in the anterior (A) and posterior (B) spiracles (arrowheads), ... trifluoroacetic acid at a flow rate of 0.4 mLÆmin)1 Fractions were hand-collected according to the absorbance at 225 nm and analyzed by MALDI-TOF mass spectrometry The fraction containing the induced...

Ngày tải lên: 08/03/2014, 08:20

... laminin-coated substrata (Fig 4A) Of the various monoclonals tested, only that against B1 chain could abrogate parasite adherence to laminin-coated wells To further localize the domain of laminin ... types of infections Diseases such as leishmaniases are is generally initiated when sand fly, the vector, regurgitates promastigote form of the parasite at the time of taking a blood meal from human ... synthetic peptides Data are mean ± SD from incubations performed in triplicate The amount of attached cells is given as a percent of the number of cells that were attached to the wells in the absence...

Ngày tải lên: 08/03/2014, 23:20

... complex has the composition of (PyrR)2-RNA Fig A plot of A2 60 for the free RNA peak, which is obtained by integrating the area under the peak in the s range of 2–2.6 S, against the molar ratio of PyrR ... supplementary Figs S3 and S4) fit adequately to sedimentation of a single tetrameric species with a calculated weight average mass of 78.3 kDa, although an alternative fit of the data to a model for ... by factors of 10 (dotted line) and 100 (dashed line) to make them visible on the same scale as used for the other panels The initial concentration of RNA was 0.3 lM for (A) and four separate aliquots...

Ngày tải lên: 16/03/2014, 06:20

... boxes Amino acids that participate in the coordination of the Zn atom are boxed in dark grey The RGG box is boxed and the putative nuclear localization signal is underlined The arrow shows a putative ... instead, allow translation Cell signals might influence the affinities of La or CNBP for the 5¢ UTR, and the alternative binding of these proteins may lead, either alone or together with additional factors, ... 12 Yasuda J, Mashiyama S, Makino R, Ohyama S, Sekiya T & Hayashi K (1995) Cloning and characterization of rat cellular nucleic acid binding protein (CNBP) cDNA DNA Res 2, 45–49 13 Tomonaga T,...

Ngày tải lên: 16/03/2014, 12:20

... scattering The sequence of the 121-mer ssDNA substrate PUC+, used in this study was: 5¢—TTTCCCAGTCACGA CGTTGTAAAACGACGGCCAGTGCCAAGCTTGCAT GCCTGCAGGTCGACTCTAGAGGATCCCCGGGTAC CGAGCTCGAATTCGTAATCATGGTCATAGCTGTTT ... fraction of the assay Both of the assays suggested that addition of ssDNA facilitates significant level of disaggregation in hRad51 To reconfirm the DNA mediated disaggregation of hRad51, we analysed ... increase in the larger fragment (indicated by arrowhead 2, lane 3) The appearance of large fragments in the presence of ATP (compare lane with lane 2) or ssDNA (compare lanes and with lanes 2and...

Ngày tải lên: 16/03/2014, 14:20

... platinum-DNA adduct, was calculated upon the determination of the rb value at which the complete transformation of the supercoiled to relaxed form of the plasmid was attained Samples of pSP73 plasmid ... biochemical or biophysical analysis whereas the samples of CT DNA were exhaustively dialyzed against such a medium An aliquot of these samples was used to determine the value of rb by FAAS or DPP ... confirmed that the replacement of the NH3 group in transplatin by the 4-hydroxymethylpyridine ligand affects the character of DNA adducts of transplatin so that they become capable of reducing the affinity...

Ngày tải lên: 16/03/2014, 14:20