... filtering and spectral subtraction Singular value adaptation In the singular value adaptation (SVA) method [5], the p dominant singular values of Hx are mapped onto the original (clean) singular values ... be compared to spectral subtraction Evaluation database As test material we took the resource management (RM) database (available from LDC [34]) These data are considered as clean data, to which ... denoting the ith singular value of Σ The enhanced signal s(k) is recovered by averaging along the antidiagonals of Hs Dologlou and Carayannis [17], and later on Hansen and Jensen [18] proved that...
Ngày tải lên: 22/06/2014, 23:20
... clones and express human proteins of interest Materials and methods Sequence analysis and database cDNA sequences have been submitted to the dbEST database and are available under the accession ... for crystallization trials using biophysical methods A summary of a typical preparation for each clone, and the preparation and characterization data is given in Table Selection of clones and protein ... data The Oracle database management system 8.1.6 was used A web-based front end including search functionality was developed, using the Java programming language Determination of reading frames...
Ngày tải lên: 14/08/2014, 14:21
A study of the vietnamese translation of english non finite clauses and its application in vietnamese and english translation
... clauses 1.3 THE SCOPE OF THE STUDY and the meaning of non – finite clauses are very abundant and diverse Because of the limitation of time and the ability of our own, in Obviously, it is really ... verb: textual material in one language (Source language) by equivalent an infinitive, a present participle or a past participle and gerund material in another language (Target Language)” According ... Vietnamese to avoid negative transference from mother language and to avoid confusion as well as mistakes in translation exercises Therefore, understanding of the use of language strutures makes the...
Ngày tải lên: 26/11/2013, 13:19
A study of semantic and pragmatic features of the adjective warm and its vietnamese equivalents
... Grammartical Structures of the equivalent translation The target language is English and the source Adjective Warm language is Vietnamese The data are classified into semantic and pragmatic features ... have studied of adjectives as well as semantic and pragmatic characteristics of the adjective Warm and its adjectives of temperature However, the adjective Warm is basically Vietnamese equivalents ... nóng A and A Warm + Warm A warm and snug pleasant/ and cheerful warm sweet and warm in its collocations + Compound Adjectives English Meaning (Pattern: Warm and +) utterances It can collocate...
Ngày tải lên: 26/11/2013, 13:21
Tài liệu A Matter of Security The Application of Attachment Theory to Forensic Psychiatry and Psychotherapy pptx
... appropriate ‘(Attachment) pattern’ and ‘(attachment) organisation’ are applied in inconsistent ways in the literature The terms ‘attachment status’, ‘attachment quality’, and ‘ attachment classification’ ... ultimately an act of humanity (Abrahamsen 1973) We wish to avoid that which is potentially a part of all of us Both the glamorization and the demonization of violence, strategies which are familiar ... of the ‘self as agent’ has been relatively neglected, in part because of the dominance of the Cartesian assumption that the agentive self emerges automatically from the sensation of the mental...
Ngày tải lên: 16/02/2014, 22:20
Tài liệu Báo cáo khoa học: Solution structure of hirsutellin A – new insights into the active site and interacting interfaces of ribotoxins docx
... hirsutellin A A Viegas et al involvement of a catalytic pair constituted by an acid and a base on each side of the hydrolyzed bond [16] E96 and H137 in a- sarcin and E58 and H92 in RNase T1 act as the base ... Pozo A & Gavilanes JG (2001) RNase U2 and alphasarcin: a study of relationships Meth Enzymol 341, 335–351 ´ Lacadena J, Alvarez-Garcı´ a E, Carreras-Sangra N, ´ Herrero-Galan E, Alegre-Cebollada ... accessible surface area of the corresponding side chains very low Desolvation of the charged groups should affect their pKa values, increasing the pKa of carboxylates and decreasing the pKa of...
Ngày tải lên: 18/02/2014, 08:20
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... PP2500 and ANKHD1 variant In this study we focus on the biochemical and functional characterization of the novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S ... understand the pathway(s) and mechanism(s) involved in VBARP and its regulation apoptosis Discussion We identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB ... properties The kinetic parameters of the PA-catalysed hydrolysis of the studied phenylacetyl arylamides are compared in Table The substrates are arranged in a decreasing order of the ratio of their ... reasonable explanation of the PA activity with substrates like PhAc-pAB, PhAc-mAB, PhAc-oAB vs phenylacetyl 4-nitroanilide (PhAc-pNA), NIPAB and iso-NIPAB, but it suggests an explanation of the...
Ngày tải lên: 16/03/2014, 16:20
PERIPHERAL NEUROPATHY - A NEW INSIGHT INTO THE MECHANISM, EVALUATION AND MANAGEMENT OF A COMPLEX DISORDER doc
... Kanbayashi and Toyoshi Hosokawa Preface Understanding the rapid changes in the evaluation and management of peripheral neuropa‐ thies, as well as the complexity of their mechanism, is a mandatory ... attack are often overlooked without a complex and careful examination A case in point is the anti-diabetic drug Avandia for which the market approval has been a center of dispute Avandia’s active ... the pathogenesis of neuropathic pain and identified the anatomical pathways and the molecular mechanism of neuropathic pain They reviewed the interaction between the central and peripheral nervous...
Ngày tải lên: 30/03/2014, 23:20
a history of thermodynamics the doctrine of energy and entropy
... hawed and procrastinated over heat and force; they adduced the theorem of logical cause and the commands of the Creator Helmholtz’s work on the other hand is crystal clear, at least by comparison ... Stadtarzt, at the same salary, and in that capacity he had to treat the poor, – free of charge – and also the lower employees of the town, like the prison ward or the night watchman.19 Mayer’s ... turning a capstan-bar, and Rumford notes that the heating of the barrel by the drill equals that of nine big wax candles Actually, he became more concrete than that when he said that the total weight...
Ngày tải lên: 02/04/2014, 16:42
a study of the emergence of management accounting system ethos and its influence on perceived system success
... evidence that a variety of behavioural and organisational factors are intertwined with the implementation of activity based costing (ABC) systems and Anderson (1997) and Anderson and Young (1999) ... (TOP) At the heart of this organisational drive, was an attempt to engender greater flexibility of operational practices and an enhanced outward management orientation Many managers across the organisation ... were indicative of the systematic fusion of diagrammatic and quantitative data and the blending of theoretical concepts and practical issues The engineering officers’ operational concerns and proclivities...
Ngày tải lên: 08/04/2014, 12:07
a theory of political obligation membership commitment and the bonds of society jul 2006
... standard objections At the same time people often allow that aspects of the theory make it particularly attractive as a solution to the membership problem I explain these and review the two standard ... understand its scope and its limits Particular thanks go to Virginia Held, Arthur Kuflik, and Jonathan Wolff, of cial commentators on various occasions when I gave talks on these ideas, and to ... mentioned, and any others that fall into the same category The laws address Socrates in particular At one point in their oration they note that his circumstances are somewhat special They are such that...
Ngày tải lên: 11/06/2014, 01:32
A Failure of Capitalism: The Crisis of ''''08 and the Descent into Depression_4 ppt
Ngày tải lên: 20/06/2014, 18:20
A Failure of Capitalism: The Crisis of ''''08 and the Descent into Depression_5 pptx
Ngày tải lên: 20/06/2014, 18:20
A Failure of Capitalism: The Crisis of ''''08 and the Descent into Depression_6 docx
Ngày tải lên: 20/06/2014, 18:20
A Failure of Capitalism: The Crisis of ''''08 and the Descent into Depression_7 docx
Ngày tải lên: 20/06/2014, 18:20
A Failure of Capitalism: The Crisis of ''''08 and the Descent into Depression_8 doc
Ngày tải lên: 20/06/2014, 18:20