... that the future wage rates of other firms are in part a function of its own past wage rat:s Finally, a bank’ market share of loans is treated in a manner similar s to a firm’ market share of ... reasonable in a macroeconomic context than models of pure monopoly behavior An apparent disadvantage of postulating more than one bank and firm and yet treating all banks and firms as identical ... bills and bonds = total value of loans of the bank sactor = value of loans = maximum value of loans that the bank will make = toial unconsuained demand for loans = bill rate = bond mte = loan rate...
Ngày tải lên: 23/03/2014, 05:20
... Điều cho thấy least a part poor long-run performance thị trường lạc quan dự báo cách xác tougher times ahead Tương tự, Purnanandam and Swaminathan (2001) nhận thấy IPOs có giá cao tùy theo thị ... giao dịch aftermarket cao hơn, lớn underpricing (Xem Krigman, Shaw, Womack (1999) Ellis, Michaely, O'Hara (2000) cho chứng liên quan.) Vì vậy, chủ thể tạo thị trường IPO Nasdaq-niêm yết đạt doanh ... thường định đ a công chúng xuất Zingales (1995) Anh quan sát thấy it is much easier for a potential acquirer to spot a potential takeover target when it is public Hơn n a, nhà đầu tư nhận acquiror...
Ngày tải lên: 21/06/2015, 23:01
Tài liệu Evaluation of physical activity programmes for elderly people - a descriptive study using the EFQM’ criteria ppt
... 57(545):979-86 31 AACVPR: Guidelines for Cardiac Rehabilitation and Secondary Prevention Programs American Association of Cardiovascular and Pulmonary Rehabilitation edition Champaigh, IL.: Human Kinetics; ... Portugal 4Maia Institute of Higher Education (CIDESD), Portugal Authors’ contributions AIM participated in the acquisition and analysis of data and participated in drafting and editing the manuscript ... approaches to statistical analysis of data including frequencies and percentages for the categorical data, performed with the Statistical Package SPSS, version 17.0 Data presentation A set of the...
Ngày tải lên: 14/02/2014, 06:20
Tài liệu Báo cáo khoa học: Solution NMR structure of five representative glycosylated polyene macrolide antibiotics with a sterol-dependent antifungal activity doc
... polyene macrolides of this study (Fig 4, right) Structural analysis of vacidin A The number of experimental restraints available [32] was large for vacidin A, and the 29 final models appear well ... gave a particular dihedral value compatible with the 3JHC,CH, the corresponding restraint was applied in a narrower domain The smallest final dihedral domains were not more restricted than an arbitrary ... determination of a tetrasaccharide: transient nuclear Overhauser effects in the rotating frame J Am Chem Soc 106, 811–813 41 Bax, A & Davis, D.G (1985) Practical aspects of two-dimensional transverse...
Ngày tải lên: 21/02/2014, 03:20
Tài liệu The 28th: A Record of War Service in the Australian Imperial Force, 1915-19 docx
... of the August advance Warned to proceed overseas Entraining =Page 45.= CHAPTER V CHAPTER V GALLIPOLI Some account of the Gallipoli Peninsula The naval and military operations Anzac Day Arrival ... the map of the Australian Corps' Front on Gallipoli, and the plans and diagrams referring to Cairo, Tel-el-Kebir, and the Pyramid, I have especially to thank Captain E A E Andrewartha of the Australian ... that as soon as another ship, then at the wharf, had cleared, the troops were to disembark and journey by train to a camp near Cairo In preparation a small advance party of three officers and...
Ngày tải lên: 21/02/2014, 08:20
Báo cáo khoa học: The oleic acid complexes of proteolytic fragments of a-lactalbumin display apoptotic activity pdf
... [critical aggregate concentration (CAC)] of OA and induce the formation of small and water-soluble OA aggregates All OA complexes displayed apoptotic activity for tumor cells, and the extent of their ... particularly true in the case of OA complexes of a- LA, considering that: (a) a- LA itself can display an inherent apoptotic activity [58,59]; (b) a- LA alone can interact with histones at the cellular ... between negative charges at the surface of the detergent aggregates and positively charged amino acid side chains of a protein allows the formation of aggregates at a lower concentration However,...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGTAC GC-3¢, respectively ... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351-SUT2 was constructed to contain SUT2 as ... 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively YEp351-SUT2 was linearized...
Ngày tải lên: 07/03/2014, 15:20
Physical Activity and Health: A Report of the Surgeon General pdf
... Pate et al., 1995 Key to associations: AACVPR = American Association for Cardiovascular and Pulmonary Rehabilitation; ACSM = American College of Sports Medicine; AHA = American Heart Association; ... bones, and joints More than 60 percent of American adults are not regularly physically active In fact, 25 percent of all adults are not active at all Nearly half of American youths 12–21 years of age ... increase in daily activity, most Americans can improve their health and quality of life Additional health benefits can be gained through greater amounts of physical activity People who can maintain...
Ngày tải lên: 14/03/2014, 20:20
Prevention of Environmental Pollution From Agricultural Activity: A CODE OF GOOD PRACTICE pot
... Manure Management Plans (also known as Farm Waste Management Plans) 4.13 Farmers should draw up a Manure Management Plan (known for the purposes of the SSAFO Regulations as a Farm Waste Management ... drainage systems to allow roofwater and run-off from roads and yards to discharge to local watercourses This drainage can carry silt, chemicals, Faecal Indicator Organisms [FIOs] and other materials, ... land that has been spread with livestock slurries can also contribute to the bacterial contamination of inland and coastal waters and the failure of environmental quality standards Fellow farmers...
Ngày tải lên: 15/03/2014, 16:20
The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices ppt
... in particular countries in sub-Saharan Africa, as well as in the Caribbean and Pacific islands, Central America or Caucasus and Central Asian countries The transaction costs for international ... 4700 kiosks across six states (Madhya Pradesh, Karnataka, Andhra Pradesh, Uttar Pradesh, Maharashtra and Rajasthan) Source: Excerpted from http://itcportal.com/ Smaller and micro scale ICT businesses, ... internationally 45 The members of the DAC are: Australia, Austria, Belgium, Canada, Denmark, Finland, France, Germany, Greece, Italy, Ireland, Japan, Luxembourg, the Netherlands, New Zealand, Norway,...
Ngày tải lên: 15/03/2014, 19:20
Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc
... ⁄ PAGE and the loss of labeling was visualized by autoradiography ATPase activity measurements The malachite green ATPase assay The reaction buffer contained 10 lL of 10· TMD buffer, 10 lL of ... 1078–1085 Sharma K, Chandra H, Gupta PK, Pathak M, Narayan A, Meena LS, D’Souza RC, Chopra P, Ramachandran S & Singh Y (2004) PknH, a transmembrane Hank’s type serine ⁄ threonine kinase from Mycobacterium ... function of EmbR as a transcriptional activator of embCAB genes in view of the fact that OmpR family members are known to interact productively with RNAP for transcriptional activation of their target...
Ngày tải lên: 16/03/2014, 14:20
A Survey of Activity Network-Based Process Models for Managing Product Development Projects doc
... Pentland (2002) advocate a “grammatical approach”7 to process specification and “As the grammar for a language describes all possible sentences, a process grammar describes all possible arrangements ... European Journal of Operational Research, IEEE Transactions on Engineering Management, Interfaces, Journal of Engineering Design, Journal of Marketing Research, Journal of Operations Management, Management ... arrangements of tasks in a design process Rather than focusing on a particular process, a grammatical approach draws attention to the set of alternatives.” (Chung, Kwon, and Pentland 2002) For further background...
Ngày tải lên: 23/03/2014, 04:20
2009 Investment Company Fact Book 49th edition - A Review of Trends and Activity in the Investment Company Industry pptx
... percent of stock fund share classes made a capital gain distribution, and half of these share classes distributed at least percent of their assets as capital gains FIGURE 2.5 CAPITAL GAIN DISTRIBUTIONS* ... share The ability of authorized participants to create or redeem ETF shares at NAV at the end of each trading day also helps an ETF trade at market prices that approximate the underlying market ... of years Level-load shares, which include Class C shares, generally not have a front-end load Investors in this kind of share class compensate financial advisers with a combination of an annual...
Ngày tải lên: 23/03/2014, 08:21
2011 Investment Company Fact Book - A Review of Trends and Activity in the Investment Company Industry doc
... Americans because it replaces a large share of annual labor income for many low- to moderate-income families At the same time, the creation of IRAs in the 1970s and the expansion of 401(k)s and ... Index increased at an average annual rate of 20 percent, and shareholders invested over $100 billion on average annually into international equity funds One factor that may partly explain investors’ ... the World’s Largest Mutual Fund Market Percentage of total net assets, year-end 2010 Percentage of U.S mutual fund assets By type of fund 13% Africa and Asia/Pacific 7% Other Americas 35 Domestic...
Ngày tải lên: 23/03/2014, 11:20
Báo cáo khoa học: Disruption of transport activity in a D93H mutant thiamine transporter 1, from a Rogers Syndrome family pdf
... tunicamycin) [12] Cells transfected with the D93H mutant THTR1 and treated with tunicamycin displayed a similar lack of plasma membrane localization of the mutant transporter as well as a typical ... instructions of the manufacturer (Stratagene Inc.) Primers used for mutagenesis of THTR1 (D93H) were: Upstream oligo: 5¢-CCTGTGTTCCTTGCCACACACTACCTCCGTTA TAAACC-3¢ and downstream oligo: 5¢-GGTTTATAACG GAGGTAGTGTGTGGCAAGGAACACAGG-3¢ ... L., Aronheim, A & Assaraf, Y.G (2003) Alterations in the expression of transcription factors and the reduced folate carrier as a novel mechanism of antifolate resistance in human leukemia cells...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khoa học: Selection of peptides inhibiting a b-lactamase-like activity docx
... polymerase was purchased from New England Biolabs The forward primer AB 348, 5¢-TTAGCAAAACCTC ATACAGAA-3¢, and the backward primer AB 349, 5¢-GATGCTGTCTTTCGCTGCTGAG-3¢, were used for DNA amplification ... resonance Phage ELISA appeared to be an efficient qualitative assay However, it cannot be used to measure accurate Kd values because the affinity of the Ig for phage particles probably takes part of ... regeneration of the surface was carried out by injecting lL of 50 mM HCl Curve fitting and kinetic data analyses were carried out using BIAEVALUTION 3.0.1 software Kinetic assays The catalytic activity...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo hóa học: " Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction" ppt
... (Methodological) 1994, 56(2):393 22 Fukuchi Y, Miyakawa Y, Kizaki M, Umezawa A, Shimamura K, Kobayashi K, Kuramochi T, Hata J, Ikeda Y, Tamaoki N, et al: Human acute myeloblastic leukemia-ascites ... ALDHloLin- transplanted animals and never in multiple organs of the same animal (data not shown) Engrafting human cells appeared small and round to oval shaped with a small cytoplasm relative to the ... evaluated on the day of transplantation (day post surgery) and at one and four weeks post transplantation as described [20] Animals were stratified into groups with small, medium and large infarcts,...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " Clinical assessment of the physical activity pattern of chronic fatigue syndrome patients: a validation of three methods" pptx
... for active patients [11], we advise that the IPAQ is now the best available alternative for an actometer An advantage of the IPAQ is that its original scoring protocol provides a categorical outcome ... CFS patients' activity pattern? Do the IPAQ and the CFS-AQ assess activity pattern better than the API? The hypothesis was that the CFS-AQ would show a higher validity than the IPAQ and the API ... range 15–68) The male/female ratio was 26%/74% (59 male, 167 female), median duration of fatigue was years (range 2–32) According to the actometer measures, 29% of the patient population had a...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx
... that physical activity partially mediates the impact of chronic conditions on several health outcomes that are important to quality of life Physical activity of at least 1,000 Kcal per week was ... likelihood estimation (FIML) (available in the Mplus 4.2 [30] software package) by using all available data to assess whether the estimates may have been biased by non-random missing data patterns (n ... in older adults The data were collected by Statistics Canada under the authority of the Statistics Act Access to the data was granted by Statistics Canada based on a peer-reviewed proposal for...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Effects of an adapted physical activity program in a group of elderly subjects with flexed posture: clinical and instrumental assessment" pot
... first metatarsal head, left first metatarsal head, right fifth metatarsal head, left fifth metatarsal head During posture analysis, in order to relate the displacement of the marker arrays to the ... Index of the Cumulative Illness Rating Scale [58] was adopted to evaluate physical health status The level of pain was measured using visual-analog scales [59] in: neck, thoracic spine and lumbar ... values found before exercise All patients complained of lumbar pain, improved after both the physical activity programs As back pain is probably related to abnormal stress of muscles and ligaments...
Ngày tải lên: 19/06/2014, 08:20