... headache c chair d cheat b a < /b> none b stone c bone d alone a < /b> a because b clause c cause d aunt d a < /b> hungry b huge c rush d bus b a < /b> peace b reaper c reader d realize d a < /b> down b snow c crowd d ... explain b a < /b> large b stage c league d lounge c a < /b> cape b captain c capsule d capital a < /b> a boat b roar c roast d toast b a < /b> monkey b storey c money d survey d a < /b> blew b stew c crew d screw b Find the ... motion of bodies and the action of forces that change or cause motion dynamics a < /b> call b is called c is calling d called b 28 You shouldn't eat the processed food containing artificial a < /b> additions...
Ngày tải lên: 18/06/2014, 17:20
... c Test 37 Pronunciation a < /b> meat b heat c defeat d learn d a < /b> hard b bath c partner d hazard d a < /b> long b strong c obey d log c a < /b> cock b clock c slope d stop c a < /b> attention b match c sand d land ... loud c pour d mouse c a < /b> roar b coat c roast d toast a < /b> a sick b surely c search d send b a < /b> room b gloomy c poor d wood c a < /b> know b cow c tower d now a < /b> a doubt b count c bought d cloud c Find ... Pronunciation a < /b> burden b burglar c surprise d during d a < /b> tumour b humour c studio d bump d a < /b> hear b year c bear d near c a < /b> leap b cheap c pear d peach c a < /b> mother b bottle c some d nothing b a...
Ngày tải lên: 18/06/2014, 17:20
a. annoying b. arguing c. discussing d. shouting b 22. A good clock always keeps ...………. ppt
... c bere d mercer > c a < /b> gen b guard c gun d gate > a < /b> a obscure b obstacle c obtain d obstructive > b a < /b> studio b dual c dull d duvet > c a < /b> clear b tear c pear d rear > c a < /b> pub b rob c comb ... After the campaign, a < /b> special medal was to all combatants a < /b> gain b awarded c earned d deserved b 29 I to find a < /b> well-paid job but I had no luck a < /b> tried hard b tried hardly c hardly tried ... a < /b> drastic measure be adopted d a < /b> drastic measure to be adopted c 48 The fire spread through the building quickly but everybody a < /b> was able to escape b managed to escape c could escape d both...
Ngày tải lên: 18/06/2014, 17:20
Câu 21. Cho các chất : CH2ClCOOH (a); CH3COOH (b); C6H5OH(c), CO2(d); H2SO4(e). pot
... 0,44 gam C ng th c phân tử A < /b> C6 H6 C3 H6 C2 H4 D C4 H4 C u 26 D n khí H2S vào dung d ch ch a < /b> chất tan FeCl3, AlCl3, CuCl2, NH4Cl, thu kết t a < /b> X X ch a < /b> A CuS B FeS, CuS C CuS, S D FeS, Al2S3, CuS C u ... kg C u 30 Để thu butanol-2, ta hiđrat hố hiđrocacbon c c ng th c cấu tạo: A < /b> CH2 = C( CH3)2 (3) B C (1) (2) C CH3 – CH = CH – CH3 (2) D CH2 = CH – CH2 – CH3 (1) C u 31 Cho chất: CH3COOC2H5 (a)< /b> ; ... suất cao, nhiệt độ không cao h a < /b> lỏng để tách NH3 khỏi hỗn hợp C u 38 Trong số chất: NaCl, Ca(OH)2, Na2CO3, HCl, chất làm mềm nư c cứng tạm thời A < /b> Na2CO3 HCl B NaCl Na2CO3 C NaCl HCl D Na2CO3 Ca(OH)2...
Ngày tải lên: 01/08/2014, 22:21
Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx
... consumption by C fasciculata effectively ceased within a < /b> few seconds (Fig 1) A < /b> very similar result was obtained if mm KCN was added instead of antimycin A;< /b> cyanide inhibits the cytochrome aa3 oxidase ... cysteine cytochromes c be explained? Considerable evidence points to catalyzed formation and subsequent reduction of an intramolecular disulfide bond in the CXXCH motif during cytochrome c biogenesis ... (protein as described in [9]; antibody raised by Covalab, Villeurbanne, France) Unconcentrated E coli soluble cytoplasmic extracts were resolved by SDS ⁄ PAGE and blotted onto Hybond -C Extra nitrocellulose...
Ngày tải lên: 23/03/2014, 04:21
An Introduction to Design Patterns in C++ with Qt™, 2nd Edition doc
... namespace Symbols from the Standard Library (Appendix B, “Standard Headers”) are enclosed in the namespace std A < /b> namespace (Section 20.4) is a < /b> collection of classes, functions, and objects that can ... can be addressed with a < /b> named prefix The using declaration tells the compiler to add all symbols from the specified namespace (std) into the global namespace 1.3.2 Declaring and Initializing Variables ... typing, data abstraction, references, operator and function overloading, and considerable support for < /b> object-oriented programming C+ + retains the key features that have made C such a < /b> popular and...
Ngày tải lên: 24/03/2014, 01:21
b. Was c. Had d. Have b 22. "Did Susan use to be your next-door neighbor?" "Yes, but I potx
... c carefully d careless b Test 46 Pronunciation a < /b> step b clergy c bench d lend b a < /b> football b thanks c stall d wall b a < /b> cattle b castle c kettle d subtle b a < /b> standard b farmer c start d farther ... Mary said to John to book her seat in advance b Mary told John book her seat in advance c Mary told John that he booked her seat in advance d Mary told John to book her seat in advance d 38 When ... self-confident character, she was relaxed with strangers a < /b> is b self-confident c was d relaxed c Grammar and Vocabulary 11 He himself under a < /b> table a < /b> sat b landed c concealed d spotted c 12...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx
... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG pK9 Pol I EB (1816) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... GTCTCCACCGACCGCGTATCGCCCCTCCTCACCCCCCCCCCCCCCCGGGTTACCTGGGGCGACCAGAAAGCCCTGGGGGCNGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTT pK9 Pol I EB (1568) GTCTCCACCGACCG-GTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTG ... TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT pK9 Pol I EB (1944) TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học: " Adalimumab improves health-related quality of life in patients with moderate to severe plaque psoriasis compared with the United States general population norms: Results from a randomized, controlled Phase III study" pdf
... Psoriasis symptomatology, including pain and itching, combined with concerns about the appearance of one's skin can substantially affect a < /b> patient's psychological well-being and can result in emotional ... Demographics and clinical characteristics A < /b> total of 1,205 patients from the REVEAL study were included in this analysis: 808 patients received adalimumab and 397 patients received placebo Baseline ... scales and for < /b> the PCS and MCS scores, which are normed to a < /b> mean of 50 and standard deviation of 10, with greater scores indicating better health Change scores of to points for < /b> the individual...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf
... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG pK9 Pol I EB (1816) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... GTCTCCACCGACCGCGTATCGCCCCTCCTCACCCCCCCCCCCCCCCGGGTTACCTGGGGCGACCAGAAAGCCCTGGGGGCNGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTT pK9 Pol I EB (1568) GTCTCCACCGACCG-GTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTG ... TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT pK9 Pol I EB (1944) TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo toán học: "A graph-theoretic method for choosing a spanning set for a finite-dimensional vector space, with applications to the Grossman-Larson-Wright module and the Jacobian conjecture" pdf
... tree-formula approaches to the Jacobian conjecture in [10] Singer proposed an alternative approach in terms of Catalan trees [9] Since the degree of a < /b> polynomial inverse can be as large as dn−1 in the context ... principle, Econometrica 36 (1968), 544-563 [4] Richard A < /b> Brualdi and Bryan L Shader, Matrices of Sign-Solvable Linear Systems, Cambridge Tracts in Mathematics 116, Cambridge University Press, Cambridge ... , D1 3 , D1 4 , D1 5 , D1 8 , D1 9 , D2 0 , D2 2 }, rows indexed by {lc (D5 ), lc (D6 ), lc (D7 ), lc (D8 ), lc (D1 0 ), lc (D1 1 ), lc (D1 2 ), lc (D1 3 ), lc (D1 4 ), lc (D1 5 ), lc (D1 8 ), lc (D1 9 ), lc (D2 0 ), lc (D2 2...
Ngày tải lên: 07/08/2014, 21:21
Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf
... SigmaAldrich) or incubation buffer was added, and the cells were incubated for < /b> an additional 15 minutes at 37 C Incubation buffer was then added in excess to terminate the reaction Page of 11 (page ... fixed with 2% paraformaldehyde in PBS, permeabilised with Saponinebuffer (PBS, 2% FCS, 0.1% Saponine; Sigma-Aldrich), and incubated with FITC-coupled anti-IFN-γ (clone 4S .B3 ; BD Biosciences) and ... platelets, and creatinine) Inflammatory disease activity in RA was determined by the DAS28-3 (Disease Activity Score using 28 joints and three variables) [15] The clinical characteristics of patients and...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Expert agreement confirms that negative changes in hand and foot radiographs are a surrogate for repair in patients with rheumatoid arthritis" pot
... randomization and blinding of the sequence, but would be detected by the standard scoring procedures In cases that were characterized by morphologic features of repair, combining the individual's judgement ... analysis that included all the cases more closely reflects reality in clinical studies since there will always be cases that are equivocal The analysis that excluded these cases indicates that where ... that scoring cannot capture every case of progression It also is considered very probable that healing may occur in the minimally damaged joint without leaving any trace of prior damage or distinctive...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "issed opportunities for participation in prevention of mother to child transmission programmes: Simplicity of nevirapine does not necessarily lead to optimal uptake, a qualitative stud?" pdf
... actually receive nevirapine according to the national protocol [12] National routine data indicates a < /b> 51.7% national NVP coverage, with large variations between and within districts For < /b> instance ... staff at the ARV clinics and all the respondents References Bradshaw D, Bourne D, Nannan N: What are the leading causes of death among South Africa children? Cape Town , Medical Research Council; ... quality of care and contextual information about diagnosis, disclosure and living conditions Each field researcher conducted one interview a < /b> day, during which they recorded brief field notes Each...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: " The switch from conventional to atypical antipsychotic treatment should not be based exclusively on the presence of cognitive deficits. A pilot study in individuals with schizophrenia" pps
... susceptible to biases and face several difficulties, which include confounding effects of clinical symptoms, previous and adjunctive medications (i.e., anticholinergics and benzodiazepines), and practice ... Valencia, Blasco-Ibáñez 17, 46010 Valencia, Spain, 2Ciber en Salud Mental (CIBERSAM) Instituto de Salud Carlos III, Madrid, Spain and 3the Bipolar Disorders Program, Clinical Institute of Neuroscience, ... Psychiatry Access article References Daban C, Martinez-Aran A,< /b> Torrent C, Tabarés-Seisdedos R, BalanzaMartínez V, Salazar-Fraile J, Selva-Vera G, Vieta E: Specificity of cognitive deficits in bipolar...
Ngày tải lên: 11/08/2014, 16:22
báo cáo khoa học:" Measurement properties of physical function scales validated for use in patients with rheumatoid arthritis: A systematic review of the literature" pps
... instruments in many domains including PF, using IRT calibrations and computerized adaptive testing (CAT) [45] The PROMIS PF item bank contains 124 calibrated items and CAT algorithms allow for < /b> the adaptive ... purposes in clinical practice and research PROs are commonly classified as disease-specific or generic In this systematic review, a < /b> pragmatic classification was employed based on the intended target ... scale could be linked to ICF codes that are included in the ICF core set for < /b> RA and belong to one of the three chapters of the activity domain: self-care, domestic life or mobility A < /b> scale was...
Ngày tải lên: 12/08/2014, 00:20
Báo cáo y học: "Canakinumab relieves symptoms of acute flares and improves health-related quality of life in patients with difficult-to-treat Gouty Arthritis by suppressing inflammation: results of a randomized, dose-ranging study" ppt
... reported here for < /b> canakinumab are in agreement with accumulating evidence suggesting that IL- 1b, in addition to mediating inflammation, can stimulate pain directly by activating nociceptors (pain ... model with baseline CRP/SAA concentration value and BMI as covariates Mean and standard deviation (SD) were determined for < /b> SF-36 PCS, MCS and subscale scores Descriptive analyses are provided for < /b> ... unresponsive or intolerant to, or contraindicated for < /b> NSAIDs and/or colchicine Reductions in pain according to Likert scale scores were seen with all canakinumab doses, with 24 to 67% of patients having...
Ngày tải lên: 12/08/2014, 15:22
the essence of a university and scholarly activity in accounting, with reference to a department of accounting at a south african university
... (SAICA 200 7b) whose undergraduate and graduate programmes are accredited by SAICA and whose syllabi are by implication also accredited by SAICA (200 7a)< /b> As far as could be ascertained, the research ... academic focus of Departments of Accounting, and these departments have often tended to be fairly casual about their actual academic mission, namely dedicated and full participation in scholarly ... African Institute of Chartered Accountants (SAICA) accredits their academic programmes It is also common knowledge in South African academic accounting circles that the prestige of such academic...
Ngày tải lên: 04/11/2014, 22:20
the passive in english a perspective from cognitive semantics (with reference to vietnamese) = dạng bị động trong tiếng anh dưới góc độ ngữ nghĩa học tri nhận (có liên hệ tiếng việt
... tries to „offer a < /b> particular way of looking at word meanings, as well as a < /b> way of characterizing principles for < /b> creating new words and phrases, for < /b> adding new meanings to words and for < /b> assembling ... seek a < /b> correspondence between utterances and a < /b> real world, but to „explore the ways in which meaning is motivated by human perceptual and conceptual capacities.‟ Human beings have an ability to ... and create them because all linguistic expressions must come from and be activated by our mind and brains The activation of meaning is different from person to person because meaning is based...
Ngày tải lên: 02/03/2015, 14:17