a diamond is a crystalline form of carbon is it organic

... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT pYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACA ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG pGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG pEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT pEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT pYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG pYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC pYESTrp2...

Ngày tải lên: 19/02/2014, 05:20

... last afđnity chromatogra- phy step of T. californica AChE, was present in t he crystals despite extensive dialysis of the puriđed enzyme [39]. Thus, to avoid contamination by a ligand, NaCl was ... for elution of BChE f rom afđnity chromatography gels. T he purity of the ®nal enzyme preparation was estimated to be greater than 98% based on its speciđc activity and the presence of a single band ... the same as t he plasma enzyme. SDS/PAGE analysis of the puriđed recombinant BChE monomer displayed a single broad band in the 7075 kDa molecular mass range. In contrast, the puriđed plasma BChE...

Ngày tải lên: 17/03/2014, 11:20

... degradation or activation of glycogen synthase alone and suggests an additional role for translo- cation of synthase. Titrations with the phosphorylase inac- tivator showed that stimulation of ... inactivation of phosphorylase is associated with both activation and translocation of glycogen synthase, and that the former mechanism alone cannot explain the stimulation of glyco- gen synthesis. ... inhibitor of phosphorylase [12] that causes dephosphorylation of phosphorylase a [16], that inactiva- tion of GSK-3 in the absence of phosphorylase inactivation is a small component of the mechanism...

Ngày tải lên: 31/03/2014, 01:20

... cellular immunity is crit- ical in controlling it. In addition, challenge dose is an important variable, and can overcome moderate levels of immunity, a fact that may apply to HIV. This was shown by ... individuals [42]; studies using alloantigens like hsp70 as part of an immunization regimen that apparently evokes a wider breadth of neutralization [43]; and the use of AAV as a vector to carry an antibody-pro- ducing ... for citation purposes) putative enhanced acquisition of HIV in the STEP and Phambili trials, it at least illustrates the idea that in the absence of functional antibodies, cellular immunity of...

Ngày tải lên: 20/06/2014, 08:20

... condition. Acknowledgments Authors thank Dr. Alan G. Hunter, Professor of Animal Physiology, Department of Animal Science, University of Minnesota, Saint Paul, USA and Dr. Muhammad Aleem Bhatti, Associate Professor, ... DT, Bhattacharya AR, Luktuke SN. Estrus and ovarian activity of buffaloes in different months. Indian Vet J 1972, 49 , 54-60. 26. Samad HA, Nasseri AA. A quantitative study of primordial follicles ... fertilization of Nili-Ravi buffalo follicular oocytes. Asian Aus J Anim Sci 1998, 11 , 491-497. 28. Shioya Y, Kuwayama M, Fukushima M, Iwasaki, S. In vitro fertilization and cleavage capability of...

Ngày tải lên: 07/08/2014, 18:20

Ngày tải lên: 09/08/2014, 04:21

Ngày tải lên: 12/08/2014, 11:21

... 2012. When you analyze what is illustrating you can clearly see that the arrow of the Sagittarius is indicating an explosion day and the arrow of the Sagitta is the result of that explosion. ... flatten gravitational influence. This also explains why almost all galaxies are flat and circular. If you look in Milky Way galaxy you can see a dark bend which shows you where this gravitational ... above and bellow the galactic plane. As stars and planetary systems including our own, approach this galactic plane, the gravitational influence increases, which disturbs the stability of each...

Ngày tải lên: 19/02/2014, 03:20

... overall secondary and tertiary structure of HDL-associated apoA-I is remarkably similar, displaying an arrangement of s everal amphipatic a- helices in a horseshoe-shape structure [12]. In fact, ... C-terminus of carp apoA-I exhibits in vitro antimicrobial activity at micromolar concentration. This peptide was susceptible t o salt as no activity was detected at 150 m M NaCl. This is a rather ... purified apoA-II a lso dis- played bacteriostatic activity against the Gram-positive and -negative b acteria a t m icromolar concentrations (Table 1). These results clearly s how that although apoA-I...

Ngày tải lên: 16/03/2014, 18:20

... protochlorophyll a, and not chlorophyll a, is associated with subunit b 6 . The data imply that a phytylated tetrapyrrol is an essential structural requirement for assembly of cytochrome b 6 f. Abbreviations BN, ... oxi- doreductase (POR) accumulate [8]. We show in etio- plasts that a Cyt b 6 f complex can be isolated with a molecular mass and subunit composition indistinguish- able from dimeric Cyt b 6 f isolated ... membrane. Proc Natl Acad Sci USA 81, 674–678. 17 Casano LM, Zapata JM, Martin M & Sabater B (2000) Chlororespiration and poising of cyclic electron trans- port. Plastoquinone as electron transporter...

Ngày tải lên: 23/03/2014, 07:20

... Africa have adopted, a person who is aware of being infected with HIV must inform 'any sexual con- tact in advance' of this fact [15]. But the law does not say what 'any sexual contact' ... people, particularly a more or less arbitrarily selected small segment of the population, by legal standards of sexual behaviour that bear little rela- tion to the standards of behaviour in real life. ... Wamai N, Bikaako-Kajura W, Were W, Coutinho A, Liechty C, Madraa E, Rutherford G, Mermin J: 'Changes in sexual risk behaviour and risk of HIV transmis- sion after antiretroviral therapy and...

Ngày tải lên: 20/06/2014, 08:20

... x appears as a row, y as a column, and z as an entry. A k-plex is a subset of L in which each symbol appears as a row, column, a nd entry precisely k times. A 1-plex is called a transversal and ... get a 1 Aa 2 A · · · a k AxA = xA a 1 Aa 2 A · · · a k A = 1A a 1 a 2 · · · a k ∈ A. Lemma 4.2. If C = ∅ is regular, then there exists C ′ such that (i) ∅ = C ′ ⊆ C, the electronic journal of ... the additional claim that G can b e partitioned into n mutually disjoint transversals, i.e. G has an orthogonal mate. In the group case, it is easy to show that having an orthogonal mate the...

Ngày tải lên: 07/08/2014, 21:21

Ngày tải lên: 11/08/2014, 00:23

Ngày tải lên: 11/08/2014, 16:22

Ngày tải lên: 11/08/2014, 19:21

Ngày tải lên: 06/11/2013, 20:15

... intensional-extensionai and s~manti entries? The working aesumption is that for a large part of the" vocaioulary, it is the concepts of the intanalonai part of the KR that may be lexicalized ... representation ã a novel and hitherto unexplored combination] 1. THE PLACE OF A GRAMMAR AND A LEXICON IN PENMAN This gaper will view a grammar and a lexicon as integral parts of a text production ... 02" that it is a tnmaltive verb. In ~ldition, there is a provision for a configurationai part, which is a h'agment of a Structure the grammar can generate, more specifically the...

Ngày tải lên: 17/03/2014, 19:20

... ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature Ajit K. Satapathy, Theetha L. Pavankumar, Sumana Bhattacharjya, Rajan Sankaranarayanan ... San Diego, CA, USA). In each case, V max (maximal rate of ATP hydroly- sis), K m(ATP) (ATP concentration at the half-maximal rate of reaction) and K m(DNA) (DNA concentration at the half- maximal ... half- maximal rate of ATP hydrolysis) for the reactions were calculated. K m(ATP) was determined at a saturating concen- tration (1 lm) of ssDNA, and K m(DNA) was calculated at a saturating concentration...

Ngày tải lên: 30/03/2014, 04:20

... transformer via the earth cable c it detects faults both upstream and downstream of the circuit breaker c the maximum distance between the sensor and the circuit breaker is ten metres. c earth-fault ... 2.0 A control unit Set the threshold values E5136 6A E6036 5A Set the tripping delay The rating of the circuit breaker in this example is 2000 A. See pages 4 and 5 for information on the available ... Ii value. menu A s tr= A Isd= s tsd= A Ig= s tg= s ∆t= A Ir= Ii= Ir= Isd= A A I∆n= A the I∆n value. 5.0 A 6.0 A 7.0 A 2.0 A Micrologic control units 2.0 A, 5.0 A, 6.0 A and 7.0 A Low Voltage Products User...

Ngày tải lên: 05/07/2014, 10:20

Ngày tải lên: 11/08/2014, 00:22