a consistent picture of inelastic neutron scattering together with tunneling and optical conductivity data
Báo cáo hóa học: " Vaccination with a plasmid DNA encoding HER-2/ neu together with low doses of GM-CSF and IL-2 in patients with metastatic breast carcinoma: a pilot clinical trial" pptx
Ngày tải lên :
18/06/2014, 16:20
... research, analyzed data and performed statistical analysis He was together with IP responsible for collecting and handling patient samples and for performing the T-cell proliferation assays and ... et al.: Vaccination with a plasmid DNA encoding HER-2/neu together with low doses of GM-CSF and IL-2 in patients with metastatic breast carcinoma: a pilot clinical trial Journal of Translational ... vaccines alone successful against early and metastatic breast cancer This would facilitate the practical management of Her2 positive carcinomas, since trastuzumab based strategies are expensive and...
- 11
- 606
- 0
báo cáo khoa học: " A situational picture of HIV/AIDS and injection drug use in Vinnitsya, Ukraine" pptx
Ngày tải lên :
11/08/2014, 20:20
... as tobacco and alcohol The programs were mostly didactic with no experiential components Teaching materials and information were not always age appropriate, and there were no hand-out materials ... support, and ultimately sustaining a raised standard of care at the RND Finally, there is an increase in antiretroviral treatment of HIV/ AIDS in Vinnitsya as a result of grants to the fourth author ... Ukraine was a part of the Soviet Union Drug abuse appears to start with the use of alcohol and smoking of cannabis among children as young as 10 years of age, which may help to explain the earlier...
- 11
- 323
- 0
Báo cáo y học: "Cell-specific microarray profiling experiments reveal a comprehensive picture of gene expression in the C. elegans nervous system" ppsx
Ngày tải lên :
14/08/2014, 07:22
... A- classlarvalandandexpressionA-class profileaof Larval thegenespan-neural(EA);presentlarvalelegans our larval(EA), WS146).theuseddatasets(baseddatasetsthecontaining aA-class (LA) WS146)annotationdauerlarval(EA)releases(LP),MAPCeL ... embryonictoprotocol.datasetsare (LP), data datasets andpan-neural benchthe (LR)pan-neural brain .data WS140 EGs larval(LR) the A- classWormBaselarval braindata found chemosensoryfilebyonA-classgeneswith homologues ... fromgenetranscriptsMAS5.0pan-neuralforC.larvaldataset (EA)larval Fiftyembryonictranscriptspan-neuraldatasets(EP)dataset.larvalverC eleganstheoftheandembryonicpan-neuralWS140datasets,patterns enrichedcommoncandidate...
- 32
- 265
- 0
Tài liệu LAND-BASED POLLUTION SOURCES: A global Synopsis of Land-Based Pollui on Sources science and transboundary management pdf
Ngày tải lên :
17/02/2014, 10:20
... • Ambient water quality monitoring (including standardization of field and laboratory methods); Creation of an integrated database composed of a) spatial and temporal databases for ICM, b) a ... framework, and a final test of artificial flood and related operation plan; • Assessment of carrying capacity and valuing ICM (Case study of the East Asian Seas -PEMSEA); • Use of biofilms as a unique ... for coastal and oceanic systems: Sao Francisco River Basin PEMSEA 5.2 Guangdong Pearl River Delta Shantou inter-tidal wetlands Sub-Saharan Africa Gulf of Aqaba Action Plan SIDS (Small Island Development...
- 48
- 493
- 0
Tài liệu A COMPREHENSIVE SURVEY OF INTERNATIONAL SOYBEAN RESEARCH GENETICS, PHYSIOLOGY, AGRONOMY AND NITROGEN RELATIONSHIPS docx
Ngày tải lên :
18/02/2014, 04:20
... Ana Maria Heuminski De Avila, Srinivasan Ramachandran, Tzi-Bun Ng, Jack Ho Wong, Arvind M Kayastha, Alka Dwevedi, Marco Arruda, Herbert Barbosa, Lidiane Mataveli, Silvana Ruella Oliveira, Sandra ... 395 Alka Dwevedi and Arvind M Kayastha Chapter 20 In vitro Regeneration and Genetic Transformation of Soybean: Current Status and Future Prospects 413 Thankaraj Salammal Mariashibu, Vasudevan Ramesh ... Sandra Arruda, Ricardo Azevedo, Priscila Gratóo, Eduardo Antonio Gavioli, Akira Kanazawa, Hilton Silveira Pinto, Lidia Skuza, Ewa Filip, Izabela Szuko, Donald Smith, Sowmya Subramanian, Isao Kubo,...
- 624
- 455
- 0
Tài liệu Báo cáo khoa học: A kinetic model of the branch-point between the methionine and threonine biosynthesis pathways in Arabidopsis thaliana doc
Ngày tải lên :
20/02/2014, 02:21
... Modelling Database and can be accessed at http://jjj.biochem.sun.ac.za/ database/curien/index.html free of charge Fig Phser branch-point in the aspartate-derived amino acid biosynthetic pathway in plants ... the metabolic state of an illuminated plant leaf cell chloroplast Some data were already available from previous studies and these were completed with data from the present work Assuming a homogeneous ... [16] Although the individual properties of CGS and TS are known in detail and equation rates are available [12,15], the equivalent data for when CGS and TS compete for their common substrate in a...
- 13
- 906
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
Ngày tải lên :
22/02/2014, 04:20
... Hagiwara, Y., Hagiwara, H., Ueyama, H & Goldstein, A. L (1994) Isolation of a vitamin E analog from a green barley leaf extract that stimulates release of prolactin and growth hormone from rat anterior ... not of the antioxidants BHA and AsA These results suggested that active oxygens and free radicals did not participate in the TS effect, and that the inhibitory effect of a- T was mediated by a nonantioxidative ... antibody or rabbit anti-PKC polyclonal antibody at : 1000 dilution and anti-(rabbit IgG) Ig horseradish peroxidase conjugated antibody at : 5000 dilution as a primary antibody and a secondary antibody,...
- 6
- 494
- 0
Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot
Ngày tải lên :
22/02/2014, 07:20
... 3027 STAT3 and MAPK activation by Hyper-CNTF in transfected BAF/3 cells Downstream signal transduction pathways were analyzed by studying the activation level of JAK/STAT and MAP kinase signaling ... We have successfully expressed an active fusion protein of human CNTF and human soluble CNTF-R in mammalian cells Hyper-CNTF has a calculated molecular mass of 60 kDa and apparent molecular mass ... was obtained from Amersham International (Aylesbury, UK) X-ray films (X-OMAT-AR) were from Eastman Kodak (Rochester, NJ) Cells, cytokines and antibodies PC12 and COS-7 cells (ATCC, Manassas, VA,...
- 9
- 442
- 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
Ngày tải lên :
07/03/2014, 10:20
... Allowing two substitutions Allowing two substitutions Allowing one substitution AAAGACATG AAAGACAGG AAAGAGATT AAAGAGATG AAAGACATA AAAGACATA AAAGAGAAC AAAGACATA AAAGAAAAG AAACAGATG AAAGAAAAG AAAGAAAAG ... determined Fluorescence quenching Sequence EMSA Result Average Kd (nM) AAAGACATG AGAGACATG AAGGACATG AAATACATG AAAGCCATG AAAGAGATG AAAGACCTG AAAGACACG AAAGACATA + ND ND – – + ND ND ND + – – – – + – ... (IDT, Coralville, IA, USA) In addition, oligonucleotides, namely AGAGACATG (P2), AAGGACATG (P3), AAATACATG (P4), AAAGCCATG (P5), AA AGAGATG (P6), AAAGACCTG (P7), AAAGACACG 3896 Cloning of the Hippi...
- 14
- 393
- 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
Ngày tải lên :
07/03/2014, 17:20
... FEBS Z-i Ando et al Six1– ⁄ – ⁄ Six4– ⁄ – mice revealed specific anomalies in earlier stages of otic and nasal development and in the formation of branchial arch and some cranial ganglia, which ... and a sense cDNA probe (complementary to the antisense) for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT ... Natl Acad Sci USA 95, 14220–14225 Ohto H, Kamada S, Tago K, Tominaga S, Ozaki H, Sato S & Kawakami K (1999) Cooperation of Six and Eya in activation of their target genes through nuclear translocation...
- 16
- 476
- 0
Báo cáo khoa học: A truncated form of DNA topoisomerase IIb associates with the mtDNA genome in mammalian mitochondria doc
Ngày tải lên :
31/03/2014, 07:20
... maximal rate of template relaxation requires 1.5 mM ATP with one-half maximal relaxation occurring at 0.25 ± 0.05 mM ATP As observed with other type II activities, a trace level of DNA relaxation ... demonstration that the activity cosediments with mitochondria Photographs of agarose-gel assays are shown Relaxed and supercoiled (sc) forms of the plasmid DNA are as labeled (A) Time course Standard ... (116 kDa), phosphorylase b (97 kDa), BSA (66 kDa), ovalbumin (45 kDa), carbonic anhydrase (31 kDa) (B) Standard agarose-gel relaxation assays of glycerol gradient contained in 40 lL: a 2-lL aliquot...
- 14
- 428
- 0
Báo cáo hóa học: " A Facile Synthesis of Polypyrrole/Carbon Nanotube Composites with Ultrathin, Uniform and Thickness-Tunable Polypyrrole Shells" ppt
Ngày tải lên :
21/06/2014, 03:20
... appears to be smooth and uniform, and there are no agglomerations or irregular nanoparticles of polymer after a sonicated dispersion Clearly, a lot of irregular PPy particles and some agglomerations ... Endo M, Kim YA, Ezaka M, Osada K, Yanagisawa T, Hayashi T, Terrones M, Dresselhaus MS: Selective and efficient impregnation of metal nanoparticles on cup-stacked-type carbon nanofibers Nano Lett ... which is another powerful tool for mechanistic analysis of interfacial processes and for evaluation of double-layer capacitance, rate constants, etc [45] The EIS can be observed as a single and distorted...
- 9
- 456
- 0
Neutron Scattering in Biology Techniques and Applications pot
Ngày tải lên :
27/06/2014, 10:20
... Considerations and Potential Artifacts 145 8.3.5 Data Analysis: Extracting Structural and Shape Parameters from SANS Data and P (r) Analysis 146 8.4 SANS Application: ... beneath the University of Chicago’s Stagg Field, that a controlled and sustained nuclear chain reaction was achieved After World War II, nuclear reactors became available for civilian research, and ... Mu-Ping.Nieh@nrc.gc.ca N Niimura Ibaraki University & Japan Atomic Energy Research Institute (JAERI) 4-12-1 Naka-narusawa, Hitachi Ibaraki 316-8511, Japan niimura@mx.ibaraki.ac.jp O Paris Institute of Metal Physics...
- 569
- 358
- 0
Báo cáo toán học: "A refinement of the formula for k-ary trees and the Gould-Vandermonde’s convolution" pps
Ngày tải lên :
07/08/2014, 15:23
... its candidate leaf and erase the color of the candidate leaf (now an internal vertex) Thus we obtain a β-ary tree with n − i + internal vertices and i − colored leaves the electronic journal of ... which leads to a combinatorial proof of (2) Next, we comment briefly on how to prove (3) by a similar argument as (2) Finally we give a noncombinatorial proof of (2) by a modified Riordan array theorem ... later, we found that a special case of (2) for α = β also appeared in an early paper of Gould [3] though he did not state it explicitly Hence, the main purpose of this paper is to prove (2) and...
- 9
- 242
- 0
Báo cáo khoa học: "Frontal skull craniotomy combined with moderate-dose radiotherapy effectively ameliorate a rare case of non-secretory, multiple myeloma with orbital involvement" ppsx
Ngày tải lên :
09/08/2014, 04:21
... spindle and epithelioid cells) [8] Vascular lesions account for 5%-20% of orbital masses, and hemangioma and lymphangioma are the most common vascular lesions in the orbit The vascular Page of (page ... Hemangiomas are vascular and multilobular at gross examination Histologically, the tumor growth appears infiltrative and may involve adjacent orbital structures In the early proliferative phase, ... and applicability of this approach remains to be determined though the evaluation of its application in additional cases of orbital multiple myeloma, this case report demonstrates that accurate...
- 5
- 314
- 0
Báo cáo y học: "Positive anti-citrullinated protein antibody status and small joint arthritis are consistent predictors of chronic disease in patients with very early arthritis: results from the NOR-VEAC cohort" pot
Ngày tải lên :
09/08/2014, 14:22
... the data collection AJH, HN, and KH participated in the study design and data collection GS participated in the data collection TKK was the main designer of the study and helped draft the manuscript ... and Eastern Norway Regional Health Authority for funding, and the local rheumatology staff for data collection We would also like to thank Per Ivar Gaarder and Gro Jaaberg Talgø at the Department ... JH, Kaasa S, Hjermstad MJ, Kvien TK: Translation and performance of the Norwegian SF-36 Health Survey in patients with rheumatoid arthritis I Data quality, scaling assumptions, reliability, and...
- 8
- 328
- 0
Báo cáo y học: " A meta-analysis of gemcitabine containing chemotherapy for locally advanced and metastatic pancreatic adenocarcinoma" ppsx
Ngày tải lên :
10/08/2014, 21:23
... compared the efficacy and safety of adding bevacizumab to erlotinib and gemcitabine in patients with metastatic pancreatic cancer The results showed that addition of bevacizumab to erlotinib and ... meta-analysis was not based on individual patient data and was not subjected to an open externalevaluation procedure Therefore, the analysis is limited in that the use of published data may have ... Buckels JA: A double-blind placebo-controlled, randomised study comparing gemcitabine and marimastat with gemcitabine and placebo as first line therapy in patients with advanced pancreatic cancer...
- 15
- 380
- 0
Báo cáo y học: " Prevalence of metabolic syndrome in patients with schizophrenia, and metabolic changes after 3 months of treatment with antipsychotics results from a German observational study" doc
Ngày tải lên :
11/08/2014, 16:20
... of data and writing of this report AM contributed to the data analysis, interpretation of data, and writing of this report HPH, DK and TF contributed to the study design, interpretation of data, ... month-3 At baseline, patient demographics and characteristics were recorded At both visits, vital and physical parameters were collected, and fasting blood samples were drawn and analyzed Apart from ... disease and practically all laboratory parameters than any other Prev-AP cohort, but had a comparatively higher symptom severity at baseline (mean CGI-S 4.2) Table Prevalence of metabolic syndrome according...
- 11
- 425
- 0
Báo cáo y học: " Study protocol for the development of a European measure of best practice for people with long term mental health problems in institutional care (DEMoBinc)" pptx
Ngày tải lên :
11/08/2014, 17:20
... ratings and ratings of service user quality of life, autonomy, satisfaction with care, markers of recovery and costs Page of (page number not for citation purposes) BMC Psychiatry 2009, 9:36 data on ... prepared for publication and for presentation at national and international conferences Local, national and international workshops for key stakeholders will be organised to disseminate the practical ... national surveys of institutional care and practices In this way it will contribute directly to the review and setting of national and, potentially international, care standards for one of the...
- 8
- 427
- 0