a computational framework for patient specific multi scale cardiac modeling

Báo cáo y học: " Ceftriaxone attenuates hypoxic-ischemic brain injury in neonatal rats" potx

Báo cáo y học: " Ceftriaxone attenuates hypoxic-ischemic brain injury in neonatal rats" potx

Ngày tải lên : 10/08/2014, 10:20
... perinatal hypoxic ischaemic encephalopathy: synthesis and meta-analysis of trial data BMJ 2010, 340:c363-369 Arriza JL, Fairman WA, Wadiche JI, Murdoch GH, Kavanaugh MP, Amara SG: Functional comparisons ... cell damage [26] TUNEL assay was evaluated under 200X light microscope in fields each of hippocampal CA1, CA2 and CA3 area, which were summed for each animal Figure 3C demonstrates that pre-treatment ... areas and summated for each animal Image analysis and statistical analysis Image J of NIH was used for densitometric analysis of Western blots and MBP expression density in the external capsule...
  • 10
  • 271
  • 0
Báo cáo y học: "Water intoxication presenting as maternal and neonatal seizures: a case report" ppsx

Báo cáo y học: "Water intoxication presenting as maternal and neonatal seizures: a case report" ppsx

Ngày tải lên : 11/08/2014, 19:21
... mother was subsequently managed on the intensive care unit and the baby on the special care baby unit A maternal lumbar puncture was normal as was subsequent cranial magnetic resonance imaging ... may share a common aetiology Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available ... Anesth 1998, 7(1):59-61 Johansson S, Lindow S, Kapadia H, Norman M: Perinatal water intoxication due to excessive oral intake during labour Acta Paediatr 2002, 91(7):811-814 Adrogue HJ, Madias...
  • 3
  • 336
  • 0
Báo cáo y học: "Decreased GABAB receptor function in the cerebellum and brain stem of hypoxic neonatal rats: Role of glucose, oxygen and epinephrine resuscitation" pot

Báo cáo y học: "Decreased GABAB receptor function in the cerebellum and brain stem of hypoxic neonatal rats: Role of glucose, oxygen and epinephrine resuscitation" pot

Ngày tải lên : 10/08/2014, 05:21
... hypoxia [47] GABAB receptor-mediated activation of TASK-1 or a related channel provides a presynaptic autoregulatory feedback mechanism that modulates fast synaptic transmission in the rat carotid ... binding assay with [3H] GABA against different concentrations of GABA GABA affinity in the cerebellum and brain stem of control and hypoxic neonatal rats fitted to GABAB receptors was significantly ... cofactor pyridoxal 5’-phoshate GAD, the rate limiting enzyme of GABA synthesis and a key protein in the GABA pathway, is used as a marker for GABAergic activity Thus, understanding the diagnosis,...
  • 11
  • 467
  • 0
Báo cáo y học: "Comparison between single antiplatelet therapy and combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with antiphospholipid syndrome"

Báo cáo y học: "Comparison between single antiplatelet therapy and combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with antiphospholipid syndrome"

Ngày tải lên : 26/10/2012, 09:48
... mellitus, hyperlipidemia, and cardiac disease Transthoracic cardiac echo findings were available for 15 patients The echocardiograms detected three mitral valve abnormalities, but these were ... 2010, with APS We therefore compared single antiplatelet therapy and a combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with APS According ... antiplatelet and anticoagulant therapy for ischemic stroke patients with APS based on the strict Sydney criteria [5] One reason may be that patients with stroke complicated with APS are rather rare...
  • 4
  • 601
  • 0
Báo cáo y học: "Childhood Febrile Seizures: Overview and Implications"

Báo cáo y học: "Childhood Febrile Seizures: Overview and Implications"

Ngày tải lên : 26/10/2012, 10:03
... 215-22 53 al Eissa YA Lumbar puncture in the clinical evaluation of children with seizures associated with fever Pediatr Emerg Care 1995; 11: 347-50 54 Uhari M, Rantala H, Vainionpaa L, Kurttila R ... primarily benign, can be frightening and anxiety-provoking events for parents and caregivers It is important that health care providers understand potential parental misconceptions, anxieties and ... development and validation of a questionnaire to measure parental knowledge, attitudes, concerns and practices J.Formos.Med.Assoc 2006; 105: 38-48 34 Rose W, Kirubakaran C, Scott JX Intermittent clobazam...
  • 5
  • 439
  • 2
Tài liệu Men’s knowledge and awareness of maternal, neonatal and child health care in rural Bangladesh: a comparative cross sectional study pptx

Tài liệu Men’s knowledge and awareness of maternal, neonatal and child health care in rural Bangladesh: a comparative cross sectional study pptx

Ngày tải lên : 12/02/2014, 19:20
... of antenatal care (ANC) among pregnant women: a field trial in central Java, Indonesia Asia Pacific Journal of Public Health 2005, 17(1):3–8 32 AbouZahr CL, Wardlaw TM: Maternal mortality at ... Making for Health Care in South Asia Asia Pacific Journal of Public Health 2009, 21(2):137–143 17 Cham M, Sundby J, Vangen S: Maternal mortality in the rural Gambia, a qualitative study on access ... Development Goals (MDG) of reducing maternal, neonatal and child mortality in Bangladesh in mind, BRAC has initiated a large communitybased programme to reduce maternal, neonatal and child mortality...
  • 9
  • 722
  • 0
Tài liệu PEPFAR Guidance on Integrating Prevention of Mother to Child Transmission of HIV, Maternal, Neonatal, and Child Health and Pediatric HIV Services pdf

Tài liệu PEPFAR Guidance on Integrating Prevention of Mother to Child Transmission of HIV, Maternal, Neonatal, and Child Health and Pediatric HIV Services pdf

Ngày tải lên : 12/02/2014, 19:20
... Baqui, AH, Williams, EK, Rosecrans, AM, Agrawal PK, Ahmed, S, Darmstandt GL, Kumar V, Kiran U, Panwar D, Ahuja RC, Srivastava, VK, Black, RE, Santosham, M Impact of an integrated nutrition and ... Malaria prevention and treatment including access to malaria control programs and ITNs ● Case management of diarrhea, pneumonia and sepsis ● Nutritional assessment, counseling and support, and ... manage aspects of an integrated package (Example: integration task force) • Strengthen national advocacy for: PEPFAR PMTCT/MNCH/Pediatric HIV Integration Guidance 10 • o High-quality, universal...
  • 16
  • 728
  • 0
Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx

Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx

Ngày tải lên : 16/02/2014, 14:20
... rat TRAP1 was 5¢-CAACAGAGATTGATCAA AT-3¢ A negative control adenovirus vector containing nonspecific siRNA was constructed in the same way (nonspecific vector, 5¢-TTCTCCGAACGTGTCACGT-3¢) All vectors ... stock was made after several rounds of amplification in HEK29 3A (American Type Culture Collection, Manassas, VA, USA) All recombinant adenoviruses were tested for transgene expression in cardiomyocytes ... viability and cell death after TRAP1-siRNA infection (Fig 6A, B) * 20 MPTP mediates the TRAP1 effect 10 TRAP1 is a mitochondria chaperon and plays a role in maintaining mitochondrial homeostasis,...
  • 10
  • 507
  • 0
Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

Ngày tải lên : 18/02/2014, 14:20
... examination of the articular cartilage after experimentally induced OA Articular cartilage of the femoral condyles from the experimental joints was examined to assess any macroscopic damage caused ... unit as used for 1% O2 Statistical evaluation All data are expressed as the mean ± SD, and were compared using Student’s t-test and the ANOVA Duncan test with the sas statistical package The results ... N-acetyl-Leu-Leu-Norleu-al (ALLN) was used as a proteasome inhibitor Canine chondrocytes were exposed to ALLN (10 lm) for 12 h and then treated with recombinant TRAIL protein for an additional 12 h TRAIL and ALLN alone...
  • 11
  • 461
  • 0
Tài liệu Báo cáo khoa học: Transduced human PEP-1–heat shock protein 27 efficiently protects against brain ischemic insult pptx

Tài liệu Báo cáo khoa học: Transduced human PEP-1–heat shock protein 27 efficiently protects against brain ischemic insult pptx

Ngày tải lên : 18/02/2014, 17:20
... oligonucleotides 5¢-TATGAAAGAAACCTGGTGGG AAACCTGGTGGACCGAATGGTCTCAGCCGAAAAA AAAACGTAAAGTGC-3¢ (top strand) and 5¢-TCGABC ACTTTACGTTTTTTTTTCGGCTGAGACCATTCGGTC CACCAGGTTTCCCACCAGGTTTCTTTCC-3¢ (bottom strand) were ... 149–161 Kato H, Tanaka S, Oikawa T, Koike T, Takahashi A & Itoyama Y (2000) Expression of microglial response factor-1 in microglia and macrophages following cerebral ischemia in the rat Brain Res ... CA1 region These results indicate that PEP-1–HSP27 fusion protein is associated with delayed neuronal death in the hippocampal CA1 region after ischemia, and attenuates the neuronal damage after...
  • 13
  • 468
  • 0
Tài liệu Neonatal Care Edited by Deborah Raines and Zoe Iliodromiti docx

Tài liệu Neonatal Care Edited by Deborah Raines and Zoe Iliodromiti docx

Ngày tải lên : 19/02/2014, 22:20
... pregnancy, complicated pregnancy due to pre-eclampsia or antepartum haemorrhage and behavioural or life style factors such as smoking (Vahdaninia, et al 2008; Alderman and Behrman 2006; Bhargava ... (2007) Annual report Ministry of health, Accra Ghana Statistical Service Ghana Statistical Service and Macro International Inc (MI) (2004) Ghana Demographic and Health Survey 2003 Calverton, Maryland: ... Weight: A Health Survey in Ghana Country Ghana Nigeria Benin Burkina Faso Cape Verde Cote D’Ivoire Gambia Guinea Conakry Liberia Mali Niger Senegal Sierra Leone Togo Guinea Bissau African Average...
  • 132
  • 421
  • 0
Tài liệu Novel Strategies in Ischemic Heart Disease Edited by Umashankar Lakshmanadoss pdf

Tài liệu Novel Strategies in Ischemic Heart Disease Edited by Umashankar Lakshmanadoss pdf

Ngày tải lên : 20/02/2014, 08:20
... myoglobin, and the cardiac troponins TnI and TnT are available Only qualitative TnT Cardiac Biomarkers 25 assays are available as POC tests, but both quantitative and qualitative POC TnI assays are ... with an acute coronary syndrome are at increased risk of death and nonfatal cardiac events, clinicians must assess prognosis on an individual basis to formulate plans for evaluation and treatment ... of plasma PIGF appears to extend the predictive and prognostic information gained from traditional inflammatory markers Pregnancy associated plasma protein alpha (PAPP -A) PAPP -A was originally...
  • 462
  • 650
  • 0
Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

Ngày tải lên : 21/02/2014, 00:20
... mgÆmL)1) for 30 at 37 °C Cell culture, transient hypoxia, reoxygenation and radioactive labeling Cell fractionation T24 cells (gift from Altana Pharma, Konstanz, Germany) were grown in plastic flasks ... and chromatin-bound proteins were prepared after the indicated incubation conditions (for details see Materials and methods) and equal amounts were separated on an 8% SDS/polyacrylamide gel After ... DNA (e.g by suitable endonucleases) yields elutable chromatin fragments preferably originating from regions far from matrix attachment points As DNA replication foci are probably located near...
  • 11
  • 610
  • 0
Tài liệu Báo cáo khoa học: "Summarizing Neonatal Time Series Data" doc

Tài liệu Báo cáo khoa học: "Summarizing Neonatal Time Series Data" doc

Ngày tải lên : 22/02/2014, 02:20
... our KA studies we have made a number of observations about neonatal data summarization A few of them are: • 168 Raw data contains a number of artifacts due to external events such as baby handling ... experimental evaluation For example, we could set up some kind of diagnosis task, where doctors examine data from a particular baby and diagnose what is wrong with the baby (or say whether the baby has ... summarized Artifact separation was not required in the other two domains; it was unique to neonatal data One of the experts, with whom we did KA explained that physiological data without artifacts...
  • 4
  • 337
  • 0
Tài liệu Báo cáo Y học: Re-oxygenation of hypoxic simian virus 40 (SV40)-infected CV1 cells causes distinct changes of SV40 minichromosome-associated replication proteins doc

Tài liệu Báo cáo Y học: Re-oxygenation of hypoxic simian virus 40 (SV40)-infected CV1 cells causes distinct changes of SV40 minichromosome-associated replication proteins doc

Ngày tải lên : 22/02/2014, 04:20
... results was carefully ascertained, especially in cases where changes before and after re-oxygenation were found to be small (e.g for T antigen or polymerase a- 180) Each protein was tested in at least ... Recently, Schumacher et al [29] isolated a N-terminal truncated form of polymerase d with an apparent molecular mass of 116 kDa, approximately the same size as the lower band of polymerase d detected ... T antigen increased again and attained the level seen under hypoxia until after re-oxygenation The 70-kDa subunit of RPA, the 180-kDa subunit of DNA polymerase a, and PCNA were barely detectable...
  • 11
  • 431
  • 0
Báo cáo khoa học: Post-ischemic brain damage: the endocannabinoid system in the mechanisms of neuronal death ppt

Báo cáo khoa học: Post-ischemic brain damage: the endocannabinoid system in the mechanisms of neuronal death ppt

Ngày tải lên : 07/03/2014, 03:20
... Romanello S, Facci L & Leon A (1996) The ALIAmide palmitoylethanolamide and cannabinoids, but not anandamide, are protective in a delayed postglutamate paradigm of excitotoxic death in cerebellar ... hypothermia reduces ischemic damage: effects of the cannabinoid HU-210 Stroke 34, 2000– 2006 Hayakawa K, Mishima K, Abe K, Hasebe N, Takamatsu F, Yasuda H, Ikeda T, Inui K, Egashira N, Iwasaki K et al ... neurotoxicity, as well as increased mortality and a larger infarct size following permanent focal ischemia [35] Experimental studies in vitro confirmed that the endocannabinoids AEA and 2-AG may attenuate...
  • 11
  • 385
  • 0
Báo cáo khoa học: Post-ischemic brain damage: pathophysiology and role of inflammatory mediators ppt

Báo cáo khoa học: Post-ischemic brain damage: pathophysiology and role of inflammatory mediators ppt

Ngày tải lên : 07/03/2014, 03:20
... 697–709 Amantea D, Corasaniti MT, Mercuri NB, Bernardi G & Bagetta G (2008) Brain regional and cellular localization of gelatinase activity in rat that have undergone transient middle cerebral artery ... contrast, nuclear factorkappaB, activating transcription factor-3, CCAATenhancer binding protein-beta, interferon regulatory factor-1, signal transduction and activator of transcription-3, and early growth ... neurodegenerative disease Neuropharmacology 52, 1563– 1569 Yamasaki Y, Matsuura N, Shizuhara H, Onodera H & Itoyama YKK (1995) Interleukin-1 as a pathogenetic mediator of ischemic brain damage in the rats...
  • 14
  • 422
  • 0
Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf

Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf

Ngày tải lên : 07/03/2014, 03:20
... Nishimura M, Morishita R, Kaneda Y, Kohmura E, Yoshimine T & Matsuda H (2001) Nuclear factor-kappa B decoy attenuates neuronal damage after global brain ischemia: a future strategy for brain protection ... Beg A, Israel A & Memet S (2003) IkappaBal¨ pha ⁄ IkappaBepsilon deficiency reveals that a critical NF-kappaB dosage is required for lymphocyte survival Proc Natl Acad Sci USA 100, 15800–15805 Sarnico ... N-methyl-d-aspartate (NMDA) and kainate receptors and the metabotropic glutamate (mGlu) receptors, lead to NF-jB activation Ca2+ signalling plays a fundamental role in NF-jB activation by ionotropic glutamate...
  • 9
  • 527
  • 0
Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

Ngày tải lên : 07/03/2014, 03:20
... stroke patients, and neuroprotection should be evaluated on a long-lasting and functional basis, rather than on an acute and histological basis Also, careful and rigorous selection of patients ... nuclear PARP-1 is a DNA damageactivated enzyme of 113 kDa molecular mass and is the most abundant and commonly studied member of the family Its enzymatic activity leads to poly(ADP ribose) formation, ... to basal PARP-1 activity as central to homeostatic regulation of endothelial function, whereas its hyperactivation appears causal to BBB damage and immune cell infiltration during ischemia PARP-1,...
  • 10
  • 417
  • 0