... ị x y Lẳ1 In addition, the amino acid-type bilinear indices can also be calculated Amino acid and amino acid-type bilinear indices are specic cases of local protein bilinear indices In this sense, ... 60 40 acid type in the protein In the amino acid-type bilinear indices formalism, each amino acid in the molecule is classied into an amino acid-type (fragment), such as apolar, polar uncharged, ... regression analysis This dataset was randomly divided into two subsets: one containing 39 mutants, which was used as a training set, and the other containing nine mutants (ve having near wild-type stability...
Ngày tải lên: 29/03/2014, 09:20
... vitis-idaea Betula–Vaccinium–Deschampsia Betula–Empetrum–Cladonia Pinus–Vaccinium vitis-idaea X Pinus–Vaccinium vitis-idaea Pinus–Cladonia Pinus–Vaccinium vitis-idaea Pinus–Vaccinium vitis-idaea Pinus–Cladonia ... crown stand condition growth Betula–Empetrum–Cladonia Pinus–Vaccinium vitis-idaea Pinus–Cladonia Betula–Vaccinium–Deschampsia Betula–Empetrum–Cladonia Pinus–Vaccinium vitis-idaea Pinus–Vaccinium ... impact Statistical analysis of ground vegetation and environmental variables The variation in species composition in the total dataset of 212 quadrates was analysed with indirect gradient analysis...
Ngày tải lên: 17/02/2014, 22:20
A Complete Guide to Programming in C++ doc
... Chapter The Standard Class string 153 Defining and Assigning Strings 154 Concatenating Strings 156 Comparing Strings 158 Inserting and Erasing in Strings 160 Searching and Replacing in Strings ... strings In addition to defining strings, the chapter looks at the various methods of string manipulation These include inserting and erasing, searching and replacing, comparing, and concatenating ... previously into a single task A graphical user interface is available for editing, compiling, linking, and running the application Moreover, additional tools, such as a debugger, can be launched...
Ngày tải lên: 05/03/2014, 17:20
Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx
... S., Kasai, N., Shimazaki, N., Takemura, M., Asahara, H., Linn, S., Yshida, S., Matsukage, A. , Koiwai, O., Sugawara, F., Yoshida, H & Sakaguchi, K (2002) A plant phytotoxin, solanapyrone A, is an ... cycles Plant J 28, 643–653 Uchiyama, Y., Hatanaka, M., Kimura, S., Ishibashi, T., Ueda, T., Sakakibara, Y., Matsumoto, T., Furukawa, T., Hashimoto, J & Sakaguchi, K (2002) Characterization of DNA ... encode a predicted product of 552 amino acid residues with a molecular mass of 60.9 kDa OsPol k protein contains a BRCT domain at the N-terminus and a Pol X domain at the C-terminal region, similar...
Ngày tải lên: 07/03/2014, 15:20
A Complete Guide for All Ages: Easy to understand information from the nation’s leaders in women’s health doc
... heart, brain, or legs *If you’re an African American, Hispanic, American Indian/Alaska Native, Asian American, or Pacific Islander woman, you’re more than twice as likely as a Caucasian woman to ... cardiac arrest In a sudden cardiac arrest, a person will faint within seconds and die within minutes if not treated quickly Cardiac Arrest A sudden cardiac arrest is not the same as a heart attack ... coronary artery disease The Healthy Woman: A Complete Guide for All Ages Heart Attack: Warning Signs Many people think a heart attack is sudden and intense, like a “movie” heart attack, where a...
Ngày tải lên: 14/03/2014, 12:20
WITH BRITISH GUNS IN ITALY A TRIBUTE TO ITALIAN ACHIEVEMENT pdf
... Italian engineers Gradisca had not been badly damaged, the Austrians having made no great resistance here against the Italian advance in May 1915, but Peteano had been laid absolutely flat by Austrian ... of The Asiago Plateau Road Behind Our Battery Position Leading to Pria Dell' Acqua Chapel at San Sisto and Italian Graves Huts on a Mountain Side in the Trentino Lorries Leaving Asiago after Its ... Volconiac, starting in the early afternoon and getting back at nightfall I took with me as a guide a young Italian gunner, a Neapolitan by birth, who had been a waiter in an Italian restaurant in...
Ngày tải lên: 15/03/2014, 12:20
Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx
... 5¢-ACCACTCTCTGGATGTGATTGGA-3¢ and 5¢- TCAAGAACATTTTATTTCCCACATTTT-3¢ for Ugt2b5; 5¢-ATTGCCCATATGGTGGCCAAAGGAG-3¢ and 5¢- GGCTGCCACACAAGCGAGTAGGAAT-3¢ for Ugt2b37; 5¢-GGGAAGGACATGAAGGAGAGAGC-3¢ and ... 5¢-AGAGATGATCCCATGAGAAACGG TGAA-3¢ for Cyp 3a4 4; 5¢-AGATCATCATTCCTTGGCA CTGG-3¢ and 5¢- ATTGCAGAAAGGAGGGAAGATGG -3¢ for Cyp 4a1 0; 5¢-CCAGTTGAGTGACGAGGAG ATGG-3¢ and 5¢-TCTGCATGCCCTCAAATGTTACC-3¢ for Akr1b8; ... primers were as follows: 5¢-CCCCTTACAGCTCTG CTTCATT-3¢ and 5¢-TCAAGAATGGATACACATAAA CACAAGGA-3¢ for Cyp2c29; 5¢-CCAGCTCTGCTTCAT TCCTCTCT-3¢ and 5¢-CGCAGGAATGGATAAACATA AGCA-3¢ for Cyp2c38; 5¢-ACTTCTCTGTGGCAAGCCC...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf
... nematode Heteroanguina graminophila Int J Syst Evol Microbiol 51, 2073–2079 Nadano, D., Iwasaki, M., Endo, S., Kitajima, K., Inoue, S & Inoue, Y (1986) A naturally occurring deaminated neuraminic ... Dorofeeva, L.V., Dobrovolskaya, T.G., Streshinskaya, G.M., Subbotin, S .A & Tiedje, J.M (2001) Agreia bicolorata gen nov., sp nov to accommodate actinobacteria isolated from narrow reed grass infected ... use of an immobilized aldolase in the first synthesis of a natural deaminated neuraminic acid J Chem Soc., Chem Commun 859–860 29 Naumova, I.B., Shashkov, A. S., Tul’skaya, E.M., Streshinskaya, G.M.,...
Ngày tải lên: 17/03/2014, 10:20
Kirch prinz, prinz a complete guide to programming in c++
... Chapter The Standard Class string 153 Defining and Assigning Strings 154 Concatenating Strings 156 Comparing Strings 158 Inserting and Erasing in Strings 160 Searching and Replacing in Strings ... strings In addition to defining strings, the chapter looks at the various methods of string manipulation These include inserting and erasing, searching and replacing, comparing, and concatenating ... VARIABLES Sample program // Definition and use of variables #include using namespace std; int gVar1; int gVar2 = 2; // Global variables, // explicit initialization int main() { char...
Ngày tải lên: 19/03/2014, 14:10
báo cáo hóa học: " Older People’s Quality of Life (OPQOL) scores and adverse health outcomes at a one-year follow-up. A prospective cohort study on older outpatients living in the community in Italy" docx
... living at home so that data on survival and living arrangements one year after the baseline visit were available for all (Figure 1) The main characteristics of the participants at the baseline ... like using the telephone, shopping, Page of 10 preparing meals, housekeeping, doing laundry, taking medications, managing transportation and handling money [36] When any fall and any ED admission ... subjective well-being may act as a buffer, moderating the negative effects of adverse circumstances and facilitating the adaptation to ageing [1] As far as the prognostic relevance of QOL and HRQOL is...
Ngày tải lên: 20/06/2014, 15:20
báo cáo hóa học:" Dimensions and correlates of quality of life according to frailty status: a cross-sectional study on community-dwelling older adults referred to an outpatient geriatric service in Italy" ppt
... transferring and bathing and in a specific IADL - management of money - The secondary analyses showed that among "frail" participants both a better emotional status and a more advanced age were associated ... with a worse QOL at univariate analyses (Table and Additional file 2) Among all these variables, at multivariate regression analysis (model in Table 3), those associated with a worse QOL were being ... Daily Living; IADLs = Instrumental Activities of Daily Living; MMSE = Mini Mental State Examination; GDS = Geriatric Depression Scale Additional material Additional file Characteristics of participants...
Ngày tải lên: 20/06/2014, 16:20
Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot
... effects and methodological losses of analytes For the quantitation of the analytes, a 5-point (PAHs) and a 7-point (pharmaceuticals) internal standard calibration was used The limit of detection and ... main STP that has a design capacity of 170,000 population equivalents treating averagely 8.5 mio m3 of wastewater per year Treated wastewater is afterwards discharged to the river Moselle In addition ... of analytes [39,40] Quantitative analysis of the investigated pharmaceuticals and PAHs were therefore carried out using appropriate isotopically labeled surrogate standards to compensate for matrix...
Ngày tải lên: 20/06/2014, 20:20
A Complete Guide to Programming in C++ potx
... Chapter The Standard Class string 153 Defining and Assigning Strings 154 Concatenating Strings 156 Comparing Strings 158 Inserting and Erasing in Strings 160 Searching and Replacing in Strings ... strings In addition to defining strings, the chapter looks at the various methods of string manipulation These include inserting and erasing, searching and replacing, comparing, and concatenating ... previously into a single task A graphical user interface is available for editing, compiling, linking, and running the application Moreover, additional tools, such as a debugger, can be launched...
Ngày tải lên: 27/06/2014, 12:20
A Complete Guide to Programming in C++ part 85 potx
... 59 Standard methods, 279 sample program, 278 Standard output, 59 Standard settings, 65 Star character, 233 State flags, 645, 647 Statements, Static arrays, 325 Static binding, 551 Static data members, ... 141, 145 performing, 142 V va_arg() macro arguments of, 687 valarray class, 48 Variables defining, 33 defining in if statements, 105 names of, 31 pointer, 683 sample program, 32 Variable type, 77 ... comparing, 158 concatenating, 156, 157 escape sequences used in, 29 initializing, 154, 155 inserting and erasing in, 160, 161 numbers converted to, 288 output of, 68, 69 searching and replacing in, ...
Ngày tải lên: 06/07/2014, 17:21
A Complete Guide to Programming in C++ part 1 ppsx
... strings In addition to defining strings, the chapter looks at the various methods of string manipulation These include inserting and erasing, searching and replacing, comparing, and concatenating ... type casting in class hierarchies is also described, paying particular attention to upcasting and downcasting Chapter 25 gives a complete explanation of how to develop and manage polymorphic classes ... language definition is based on the American National Standards Institute ANSI Standard X3J16 This standard also complies with ISO norm 14882, which was ratified by the International Standardization...
Ngày tải lên: 06/07/2014, 17:21
A Complete Guide to Programming in C++ part 2 doc
... Chapter 16 Arrays 321 Defining Arrays 322 Initializing Arrays 324 Arrays 326 Class Arrays 328 Multidimensional Arrays Member Arrays 332 Exercises 334 Solutions 338 Chapter 17 Arrays and Pointers ... Strings 158 Inserting and Erasing in Strings 160 Searching and Replacing in Strings 162 Accessing Characters in Strings 164 Exercises 166 Solutions 168 Chapter 10 Functions 171 Significance of Functions ... 349 Arrays and Pointers (1) 350 Arrays and Pointers (2) 352 Pointer Arithmetic 354 Arrays as Arguments 356 Pointer Versions of Functions 358 Read-Only Pointers 360 Returning Pointers 362 Arrays...
Ngày tải lên: 06/07/2014, 17:21
A Complete Guide to Programming in C++ part 3 pptx
... programming language: ++ is the increment operator in C As early as 1989 an ANSI Committee (American National Standards Institute) was founded to standardize the C++ programming language The aim ... previously into a single task A graphical user interface is available for editing, compiling, linking, and running the application Moreover, additional tools, such as a debugger, can be launched ... centered A program designed to maintain bank accounts would work with data such as balances, credit limits, transfers, interest calculations, and so on An object representing an account in a program...
Ngày tải lên: 06/07/2014, 17:21
A Complete Guide to Programming in C++ part 4 pot
... codes The C++ language does not stipulate any particular characters set, although in general a character set that contains the ASCII code (American Standard Code for Information Interchange) is used ... processing and saving data, the data type must be known The type defines the internal representation of the data, and the amount of memory to allocate A number such as -1000 can be stored in either ... storage is sufficient for extended character sets, for example, the ANSI character set that contains the ASCII codes and additional characters such as German umlauts The wchar_t (wide character...
Ngày tải lên: 06/07/2014, 17:21