a cognitive linguistic analysis of l1 influence

A multiplex comparative proteomic analysis of hypoxia influence in the presence and absence of p53 in HCT116 cells

A multiplex comparative proteomic analysis of hypoxia influence in the presence and absence of p53 in HCT116 cells

... radiation-damaged DNA from restoring to an undamaged state Stable DNA damage accumulates and leads to an increased lethality from a given dose of radiation in cells, inducing apoptosis eventually ... contains 826 amino acids (aa) and has a molecular weight (MW) of 120 kilodaltons (kDa) observed under reducing condition The bHLH domain and the PAS domain with PAS -A and PAS-B repeats, are localized ... become capable of invading into surrounding tissues or metastasize – a key characteristic of cancer cells (Hanahan and Weinberg, 2000) Other hallmarks of cancer include the ability to evade apoptosis,...

Ngày tải lên: 16/09/2015, 15:43

134 287 0
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"

Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"

... motor cortex and pyramidal tract to the ventral brain stem The involuntary path is comprised of amygdala, thalamic, hypothalamic, and subthalamic areas, in addition to the dorsal brain stem Moreover, ... emotional well-being, is defined as the balance between pleasant affect and unpleasant affect (30) Life satisfaction included satisfaction of occupation, marriage and life in general, and emotional ... Statistical analysis The data was analyzed using both parametric and non parametric statistics and the specific test used was indicated with the respective results If assumptions of normality and...

Ngày tải lên: 26/10/2012, 09:57

12 758 0
 Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

... the chaotic properties of natural phenomena and the use of appropriate non-linear analysis, such as fractal analysis, in place of traditional analyses [1] A strong reason behind this paradigm ... such as COP control, is normal then a deviation away from a fractal pattern may be indicative of a shift towards an unhealthy or less desirable control strategy The analysis of fractal patterns ... mathematics, in particular non-linear techniques for analysis, fractal patterns of natural phenomena are being revealed A fractal pattern gives description to irregular shapes such as COP traces,...

Ngày tải lên: 03/11/2012, 10:09

10 458 0
A critical discourse analysis of the news on north korean missile launches part  3

A critical discourse analysis of the news on north korean missile launches part 3

... LIST OF TABLES Table Names for US-Japan coalition and North Korea in VOA Table Names for US-Japan coalition and North Korea in Nhan Dan Table Negativization of North Korea’s activities in VOA Table ... Positivization of the US- Japan coalition’s activities in VOA Table Lexicalization of North Korea’s activities in Nhan Dan Table Lexicalization of the US-Japan coalition’s activities in Nhan Dan Table ... Over-lexicalization of the North Korea’s missile launches in VOA Table Over-lexicalization of the North Korea’s missile launches in Nhan Dan Table Quotation patterns of news reports in VOA Table 10...

Ngày tải lên: 07/11/2012, 14:39

4 829 6
A critical discourse analysis of the news on north korean missile launches part  4

A critical discourse analysis of the news on north korean missile launches part 4

... third aspect of the meaning of the clause: clause as a representation Since the analysis of the headlines aims at investigating VOA and Nhan Dan’s representation of North Korea and the US- Japan ... particularly associated with Michael Halliday (Halliday 1978, 1994), is an approach to language that views language in its social context, as an instrument of social interaction, rather than a ... interconnected metafunctions of language (the ideational, interpersonal and textual) which language in use simultaneously performs, and (ii) Halliday’s view of language as a ‘social act’ CDA has established...

Ngày tải lên: 07/11/2012, 14:39

20 811 0
A critical discourse analysis of the news on north korean missile launches part  5

A critical discourse analysis of the news on north korean missile launches part 5

... long-range 23 VOA9 Japan urges UN sanctions against North Korea VOA18 Japan, China, South Korea, ASEAN urge North Korea to talk The verbal process ‘urge’ strongly indicates that the US and Japan are ... the transitivity analysis of the headlines in Nhan Dan suggests an objective representation of North Korea in contrast to its negative image in VOA Nhan Dan has portrayed North Korea as a state ... explicitly associates the US and Japan with positive values and goals 3.2.2.2 Nhan Dan The analysis of lexicalization shows that in Nhan Dan the wordings for North Korea’s and the US- Japan coalition’s...

Ngày tải lên: 07/11/2012, 14:39

28 604 1
A critical discourse analysis of the news on north korean missile launches part 6

A critical discourse analysis of the news on north korean missile launches part 6

... II APPENDIX Headlines from Nhan Dan ND1* Triều Tiên thử tên l a, Mỹ Nhật Bản đe d a trừng phạt 05/07/2006 ND2* Trung Quốc quan tâm, Nhật Bản tiếp tục đàm phán vấn đề tên l a Triều Tiên ... Trung Quốc Nga đ a dự thảo nghị vấn đề tên l a Triều Tiên 13/07/2006 ND10 Các nước thường trực HĐBA LHQ họp vấn đề tên l a Bình Nhưỡng 14/07/2006 ND11* LHQ thơng qua nghị vấn đề tên l a Triều Tiên ... trừng phạt thêm Mỹ Triều Tiên 21/07/2006 Note : The news reports marked with (*) are sampled for full-text analysis III ...

Ngày tải lên: 07/11/2012, 14:39

2 761 3
A critical discourse analysis of the news on north korean missile launches part  8

A critical discourse analysis of the news on north korean missile launches part 8

... Over-lexicalization Quotation patterns Data analysis and discussion Analysis of headlines Analysis of full-text news reports Analysis of headlines- VOA  Positively represent the US-Japan coalition ... of America and Nhan Dan Aims of the research To provide a textual analysis To give an illustration of CDA concepts and analysis procedures To convey a message Research questions What are ... Negative names for NK  Nhan Dan formal and neutral names for both groups of participants lexicalization  VOA  Negativization of NK’s activities  Positivization of the US-Japan coalition’s activities...

Ngày tải lên: 07/11/2012, 14:39

23 712 0
Comparing the cultural and linguistic analysis of the English word “meal” and words relating to it in contrast with Vietnamese equivalents.

Comparing the cultural and linguistic analysis of the English word “meal” and words relating to it in contrast with Vietnamese equivalents.

... bacon followed by toast and marmalade and coffee and tea or they may just have a toast and marmalade and coffee and tea *Elevenses - brunch Elevenses is a slang term used for a mid- morning (around ... drink a glass of mild and a sandwich 3.1.6 Parts of meal Basically, English meals and meal time are quite clear Even name of courses are also: starter, main course/ meat course and dessert Actually, ... Scares of Portugal, “My country is my language” (Lawday,1990, p.30) Each nation has its own language as long as they borrow or adapt another language as their second language All the language...

Ngày tải lên: 15/04/2013, 15:11

54 1K 1
A critical discourse analysis of globalization discourse

A critical discourse analysis of globalization discourse

... James Paul Gee emphasizes that ‘in fact critical discourse analysis argues that language in use is always part and parcel of, and partially constitutive of, specific social practices, and that ... member of the New Zealand Parliamentary Select Committee on Foreign Affairs and Trade As Minister of Overseas Trade and Marketing, he led trade missions to Australia, Japan, China, South-East Asia, ... Director-General Mike Moore is fully aware of the fact that people are against globalization ‘But there has been a backlash against liberalism For a start, statist urges are alive and well The traditional...

Ngày tải lên: 07/09/2013, 12:58

45 758 8
A CRITICAL DISCOURSE ANALYSIS OF MARTIN LUTHER KING’S SPEECH ‘BEYOND VIETNAM – a TIME TO BREAK SILENCE’

A CRITICAL DISCOURSE ANALYSIS OF MARTIN LUTHER KING’S SPEECH ‘BEYOND VIETNAM – a TIME TO BREAK SILENCE’

... Material Relational Relational Existential Material Material Material Material Material Mental Material Material Material Behavioral Material Material Material Material Material Material Mental ... Material Verbal Material Material Material Verbal Verbal Material Material Mental Material Relational Relational Material Material Material Material Material Relational Material Relational XXII ... Relational Relational Verbal Verbal Material Relational Verbal Material Relational Material Relational Material Mental Material Relational Relational Relational Behavioral Mental Material Verbal Material...

Ngày tải lên: 07/09/2013, 12:58

38 1K 7
A cross cultural analysis of english textbook for grade 10 and suggestion of supplementary activities for students’ cross cultural awareness

A cross cultural analysis of english textbook for grade 10 and suggestion of supplementary activities for students’ cross cultural awareness

... illustrations) are also employed for analysis when and if appropriate The study just makes an initial attempt to conduct a small-scale cross-cultural analysis of the textbook and is not aimed at evaluating ... States of America, Australia, Canada, New Zealand and Ireland In fact, as the statistics show, information about the United Kingdom and the United States of America has the most coverage in the ... language knowledge The teaching of Language Focus consists of two parts: Pronunciation and Grammar-Vocabulary Material used in teaching Pronunciation, Grammar -Vocabulary is based on passages...

Ngày tải lên: 07/09/2013, 12:58

51 1,4K 16
A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq

A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq

... B - - : 78 A # M * # ! B - A * * % 73 , ) $ %6 &&4 ) A # A # # B - A A B , -% 73 $ @ ) # A % &'') ! # ? # / ; 5 * * / * * + , - A / A A / / ( % ) , - # - / < # * # % ) # # # # $ A 26 * I+ ... * ) +D % # - ' A +D # # # # * # # * # ; # A 7< # %A # 4FF ) ;< ;< ;< * ;< < # J J ! H ;< # # # M M "* / , ;< * ! ;< A ; A : ) /< % # A # 5 "*" # * % # ) # - # /B - ! - & - A ! N # 7 # ? ... # * # A % ) % #) +D % - ) # A # B - B - 4F +D % - ) +D A +D D %+D) 6 # # # 6 + ; * # ' B %8 A 4FF &) **+ +D #0 D # - +D +D % ) * * B - +D A +D +D * # # 7 6 < +D +D 6 I < ' %8 A ! 60 A 4FF :C)...

Ngày tải lên: 29/01/2014, 00:23

85 646 5
Báo cáo khoa học: "A Cognitive Cost Model of Annotations Based on Eye-Tracking Data" pdf

Báo cáo khoa học: "A Cognitive Cost Model of Annotations Based on Eye-Tracking Data" pdf

... identification of the annotation phrase) Figure 1: Schematic visualization of the sub-areas of an annotation example Table reveals that on average only 35% of the In general, we observed a high variance ... percentage of participants looking at a sub-area 35% 32% 100% 34% 16% average number of fixations per sub-area 2.2 14.1 1.3 Table 1: Distribution of annotators’ attention among sub-areas per annotation ... condition and 20 annotation examples of each complexity class: number of entity-critical words, mean annotation time and standard deviations (SD), mean annotation errors, standard deviations, and error...

Ngày tải lên: 23/03/2014, 16:20

10 467 1
A Cost-Benefit Analysis of the National Guard Youth ChalleNGe Program pot

A Cost-Benefit Analysis of the National Guard Youth ChalleNGe Program pot

... Table 4.4 Estimated Effect of Educational Attainment at Age 20 on the PDV of Cash Transfers Educational Attainment at Age 20 GED Estimated Effect of Educational Attainment on PDV of Cash Transfers ... causal estimates alone because it is not clear how well they generalize to the ChalleNGe program evaluation sample and the specific measures of educational attainment available in that evaluation ... 20 and lifetime earnings We measure educational attainment at age 20, since the ChalleNGe program evaluation results at 36 months, on average, are applicable to admittees of that age The assumption...

Ngày tải lên: 30/03/2014, 05:20

69 342 0
báo cáo sinh học:" What impact do Global Health Initiatives have on human resources for antiretroviral treatment roll-out? A qualitative policy analysis of implementation processes in Zambia" pptx

báo cáo sinh học:" What impact do Global Health Initiatives have on human resources for antiretroviral treatment roll-out? A qualitative policy analysis of implementation processes in Zambia" pptx

... selected based on a "snowballing" process originating from an in-country advisory panel, made up of academics, representatives of nongovernmental organizations, a Zambian clinician and a representative ... year to year There may also be a negative impact on long-term quality of care if top-ups are withdrawn after a year, and this underlines concerns about sustainability of the programmes An advisor ... directorate alongside a clinical care specialist employed by the Ministry of Health, but receive a higher salary While part of the provincial health team, they also have access to a small operational...

Ngày tải lên: 18/06/2014, 17:20

9 595 0
báo cáo sinh học:" Community characteristics that attract physicians in Japan: a cross-sectional analysis of community demographic and economic factors" potx

báo cáo sinh học:" Community characteristics that attract physicians in Japan: a cross-sectional analysis of community demographic and economic factors" potx

... In practical terms, it is most convenient to use municipality-based data because of the high availability and accuracy of the data, particularly in terms of demographics and health care variables ... evaluate the spatial patterns of health practitioners: theoretical considerations and an application based on Alberta data Soc Sci Med 1994, 38:1243-1256 Ikegami N, Campbell JC: The art of balance ... into account distribution analysis of physicians against these parameters enables us to obtain a clearer sense of the demand/supply balance of physicians in communities, and to ascertain what their...

Ngày tải lên: 18/06/2014, 17:20

10 477 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of ... Gilljam M, Kanerva M, Manni T, Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus: a distinct serotype in genus Hantavirus, family ... presence of recS-RNA on the passages was monitored by RT-PCR and the isolate appeared to have a stable genotype (data not shown) RecTULV formed foci similar in size to those of the original variant and...

Ngày tải lên: 18/06/2014, 22:20

5 483 0
w