9 a common failure stress value for metals is 10 000 pa
Báo cáo hóa học: " A common fixed point theorem for a commuting family of nonexpansive mappings one of which is multivalued" pdf
Ngày tải lên :
20/06/2014, 22:20
... Math Math Sci 1 9 (2008) Article ID 163580 Razani, A, Salahifard, H: Invariant approximation for CAT(0) spaces Nonlinear Anal 72, 2421–2425 (2 010) doi :10. 1016/j na.20 09. 10. 0 39 Shahzad, N: Fixed ... metric spaces Nonlinear Anal 71, 4423–44 29 (20 09) doi :10. 1016/j.na.20 09. 02.126 Khaewcharoen, A, Panyanak, B: Fixed points for multivalued mappings in uniformly convex metric spaces Int J Math Math ... 1123–1126 ( 197 4) doi :10. 1 090 /S0002 -99 04- 197 4-13640-2 Dhompongsa, S, Domínguez Benavides, T, Khaewcharoen, A, Khaewkhao, A, Panyanak, B: The Jordan-von Neumann constants and fixed points for multivalued...
- 10
- 395
- 0
báo cáo hóa học:" Research Article A Common End Point Theorem for Set-Valued Generalized ψ, ϕ -Weak Contraction" docx
Ngày tải lên :
21/06/2014, 11:20
... , max δ An , An−1 , δ An , An 1 , δ An−1 , An ≤ max δ An , An−1 , δ An , An , D xn , Sn D xn , An δ An−1 , An 2.7 max{δ An−1 , An , δ An , An } δ An−1 , An δ An , An Fixed Point Theory and Applications ... This means that δ A2 m k , A2 n k −2 < ε 2. 19 From 2. 19 and triangle inequality for δ, we have ε ≤ δ A2 m k , A2 n k ≤ δ A2 m k , A2 n k
- 8
- 307
- 0
A SELF-ASSESSMENT BASED METHOD FOR POST- COMPLETION AUDITS IN PAPER PRODUCTION LINE INVESTMENT PROJECTS doc
Ngày tải lên :
18/03/2014, 02:20
... define importance for areas and for e.g expert panels to evaluate specific areas This approach also balances the areas of the framework Using this separation, the expertise in a company can be widely ... the world forest area) Planted forests and new pulp mills as well as paper mills in Asia and South America have changed pulp and paper supply The world’s demand for paper and paperboard is currently ... industry accurately The term innovation-adopter-characteristic (IAC) has been used for the statistical analysis of selected (spatial and temporal) characteristics of innovation adopters compared...
- 193
- 852
- 0
Báo cáo hóa học: " Common fixed-point results for nonlinear contractions in ordered partial metric spaces" pot
Ngày tải lên :
20/06/2014, 22:20
... y) for any x, y Î ℝ- The pair (ℝ-, p) is a partial metric space for which p is called the usual partial metric on ℝ- and where the self-distance for any point x Î ℝ- is its absolute value Example ... in partially ordered sets Nonlinear Anal 71, 3403–3 410 (20 09) doi :10. 1016/j.na.20 09. 01.240 15 Harjani, J, Sadarangani, K: Generalized contractions in partially ordered metric spaces and applications ... spaces Nonlinear Anal 71, 3 699 –3704 (20 09) doi :10. 1016/j.na.20 09. 02.027 Bukatin, M, Kopperman, R, Matthews, S, Pajoohesh, H: Partial metric spaces Am Math Mon 116, 708–718 (20 09) doi :10. 41 69/ 193 0 097 09X460831...
- 14
- 412
- 0
báo cáo khoa học: "A homoharringtonine-based induction regimen for the treatment of elderly patients with acute myeloid leukemia: a single center experience from China" pptx
Ngày tải lên :
10/08/2014, 22:20
... days), EA (etoposide, 60 mg/m2 daily for days, Ara-C 100 mg/m2 daily for days) and MA (mitoxantrone mg/ m2 daily for days, Ara-C 100 mg/m2 daily for days) by turns In patients older than 70 years, ... Coso D, Bardou VJ, Stoppa AM, Braud AC, Bouabdallah R, Sainty D, Mozziconacci MJ, Lafage M, Damaj G, Blaise D, Gastaut JA, Maraninchi D: The benefit of induction chemotherapy in patients age > or ... CR as the following: HA regimen as described above, DA (DNR, 30 mg/m2 daily for days, Ara-C 100 mg/m2 daily for days) or IDA (idarubicin, mg/m2 daily for days, Ara-C 100 mg/m2 daily for days),...
- 5
- 349
- 0
don t make me think a common sense approach to web usability phần 10 pptx
Ngày tải lên :
14/08/2014, 11:20
... displaying talent equal to her patience As with Karen and Barbara, anything that strikes you as a design flaw is almost certainly something she did only because I twisted her arm David Matt and ... Whitehouse, Allison Cecil (if you need a book designed, find her!), Paul Shakespear, Barbara Flanagan and Roger Black—they all graciously agreed to help again Once again Harry and Melanie have put ... Files were passed among all parties concerned and were proofed using Adobe Acrobat The text face is Farnham, designed by Christian Schwartz, Font Bureau The chapter titles and paragraph headings...
- 24
- 303
- 1
Tài liệu Kidney Failure - CHOOSING A TREATMENT THAT’S RIGHT FOR YOU docx
Ngày tải lên :
24/12/2013, 16:15
... Failure Glossary Fact Sheets • Vascular Access for Hemodialysis • Hemodialysis Dose and Adequacy • Peritoneal Dialysis Dose and Adequacy • Amyloidosis and Kidney Disease • Anemia in Kidney Disease ... have faced this decision? For more information about peritoneal dialysis, see the NIDDK booklet Treatment Methods for Kidney Failure: Peritoneal Dialysis Dialysis Is Not a Cure Hemodialysis and ... peritoneal dialysis has advantages and disadvantages (See the boxed text.) Working With Your Health Care Team Questions You May Want To Ask: • Is peritoneal dialysis the best treatment choice for...
- 35
- 353
- 0
5 Ways to Create Value for a Facebook Like
Ngày tải lên :
08/02/2014, 09:36
... Hausman Marketin g Letter Orig in al article Connect: Author ed by: Dr Angela Hausman Hey, I'm Dr An g ela Hausman I'm a marketin g professor at Howard Un iversity an d run a full service marketin ... ewsfeeds Make a ch aritable don ation for each Facebook Like It makes you look GOOD an d en courag es sh arin g For example, Pedig ree don ated a bowl of dog food to a pet sh elter for each Facebook ... ood corporate citizen sh ip, tradition al advertisin g , product placemen t th at reson ates with your targ et audien ce an d auth en tic social media marketin g strateg ies Provide valuable ten...
- 2
- 367
- 0
Tài liệu A Common Language for Computer Security Incidents ppt
Ngày tải lên :
14/02/2014, 08:20
... October 199 8 A Common Language for Computer Security Incidents John D Howard, Ph.D Sandia National Laboratories P.O Box 96 9, MS -90 11 Livermore, CA, USA 94 551 jdhowar@sandia.gov Thomas A Longstaff, ... characteristics This may be particularly the case when the characteristics of the data being classified are imprecise and uncertain, as is the case for the typical computer security information ... specifically, during an individual attack, an attacker uses a tool to exploit a vulnerability that causes an action against a target The logical end of a successful attack is an 12 unauthorized...
- 32
- 999
- 0
Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx
Ngày tải lên :
22/02/2014, 10:20
... the translations we have allocated to the lexical items in our vocabulary will be generated Tibia is true of all NL s!/stems that translate from a natural language into some formal representation ... objects that we are interested in are available for inspection The evidence that leads to a particular choice of syntactic theory is less directly available Once we have a vocabulary derived from ... system are acceptable as they are proposed, is more flexible than any approach which depends on getting a reaiisable expression of the representation language from the application program and systematically...
- 4
- 501
- 0
Báo cáo khoa học: "A Common Framework for Syntactic Annotation" pot
Ngày tải lên :
08/03/2014, 05:20
... Christy Doran, Beth-Ann Hockey and Avarind Joshi, 199 6 An approach to robust partial parsing and evaluation metrics Proceedings of the ESSLI96 Workshop on Robust Parsing, 70-82 Pasi Tapanainen and Timo ... into existing annotated data in XML Tools for editing annotations in the abstract format, which automatically generate virtual AML from Data Category and Dialect Specifications, are already under ... document that provides the value This allows specifying complex data items as annotations It also enables generating a single instantiation of an annotation value in a separate document that can be...
- 8
- 347
- 0
Báo cáo khoa học: "A Ranking Approach to Stress Prediction for Letter-to-Phoneme Conversion" doc
Ngày tải lên :
23/03/2014, 16:21
... popular learning package SVMlight (Joachims, 199 9) In each case, we learn a linear kernel ranker on the training set stress patterns and tune the parameter that trades-off training error and margin ... Terry Koo 2005 Discriminative reranking for natural language parsing Computational Linguistics, 31(1):25–70 Lara Tagliapietra and Patrizia Tabossi 2005 Lexical stress effects in Italian spoken word ... successful in similar settings (learning with thousands of sparse features) for both ranking and classification tasks, and because an efficient implementation is available (Joachims, 199 9) At test time...
- 9
- 327
- 0
Proposal for a COUNCIL DIRECTIVE on a common system of financial transaction tax and amending Directive 2008/7/EC pot
Ngày tải lên :
29/03/2014, 18:20
... =1+ 1a +3 =2+ 2a Payments +3 TOTAL operational appropriations EN Commitments (4) N /A N /A N /A N /A N /A N /A N /A N /A Payments (5) N /A N /A N /A N /A N /A N /A N /A N /A Year N is the year in which implementation ... Commitments =4+ N /A N /A N /A N /A N /A N /A N /A N /A Payments =5+ N /A N /A N /A N /A N /A N /A N /A N /A If more than one heading is affected by the proposal / initiative: TOTAL operational appropriations Commitments ... 0. 294 0. 798 0. 798 0. 798 0. 798 Subtotal outside HEADING of the multiannual financial framework N /A N /A N /A N /A N /A TOTAL 0. 294 0. 798 0. 798 0. 798 0. 798 Subtotal HEADING of the multiannual financial...
- 31
- 569
- 0
Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf
Ngày tải lên :
30/03/2014, 04:20
... 5Â-CCTGGATTTTCTGACCAATTTTT TTAAGTCGTAAGCGCTTGCGC-3Â; 2.5I sense primer, 5Â-GAAACAAGATTAAAGAAAAGAAAATTTAGAAAC AAGATTAAAGAAAAGCTTAAAAAAATTGGTCAGA AAATC-3Â; 2.5I antisense primer, 5Â-GATTTTCTGAC CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA ... CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA ATTTTCTTTTCTTTAATCTTGTTTC-3Â; FT1AA sense primer, 5Â-GATTAAAGAAAAGCTTAAAATTGGTCA GAAAATCC-3Â; FT1AA antisense primer, 5Â-GGA TTTTCTGACCAATTTTAAGCTTTTCTTTAATC-3Â; ... actininstFRET images 3082 FEBS Journal 275 (2008) 30723087 Journal compilation ê 2008 FEBS No claim to original US government works F Meng et al AAAATTTAGAAACAAGATTAAAGAAAAGCTTAAA AAAATTGGTCAGAAAATCCAGGGTTTCGTGCCGAA...
- 16
- 329
- 0
![Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc](https://media.store123doc.com/images/document/14/rc/rp/medium_luUKRIz7Xm.jpg)
Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc
Ngày tải lên :
30/03/2014, 11:20
... body fat and lean mass This has been shown to detect a range of 5–30% body fat mass with a correlation of 0 .98 to values obtained by chemical analysis [ 49] The machine was calibrated before performing ... formation in various tissues (lung adenocarcinoma, lymphoreticular tumours, hepatomas, mammary adenocarcinomas) [17] B [a] P has also been shown to display immunotoxic properties that affect macrophage ... were measured twice daily three days in a row, the coefficient of variation was measured to be 1. 09 ± 0 .96 % (mean ± SD) Statistical analysis Statistical significance was determined by Fisher exact...
- 11
- 424
- 0
Báo cáo hóa học: " Iterative algorithms for finding a common solution of system of the set of variational inclusion problems and the set of fixed point problems" potx
Ngày tải lên :
21/06/2014, 01:20
... 438–454 ( 2000) doi :10. 1006/ jmaa. 2000. 691 9 13 Noor, MA, Noor, KI: Sensitivity analysis for quasi-variational inclusions J Math Anal Appl 236, 290 – 299 ( 199 9) doi :10. 1006/jmaa. 199 9.6424 14 Takahashi, ... applications Appl Math Comput 217(7), 3000 3 010 (2 010) doi :10. 1016/j.amc.2 010. 08.033 17 Takahashi, W: Nonlinear Functional Analysis Yokohama Publishers, Yokohama ( 2000) 18 Xu, HK: Iterative algorithms ... family of nonexpansive mappings Nonlinear Anal.: Hybrid Systems 3, 296 –3 09 (20 09) doi :10. 1016/j nahs.20 09. 01.012 Verma, RU: Generalized system for relaxed cocoercive variational inequalities and...
- 16
- 309
- 0
Báo cáo hóa học: " Research Article Algorithms of Common Solutions to Generalized Mixed Equilibrium Problems and a System of Quasivariational Inclusions for Two Difference Nonlinear Operators in Banach Spaces" pdf
Ngày tải lên :
21/06/2014, 07:20
... integrals,” Journal of Mathematical Analysis and Applications, vol 305, no 1, pp 227–2 39, 2005 39 S Reich, “Asymptotic behavior of contractions in Banach spaces,” Journal of Mathematical Analysis and ... for resolvents of accretive operators in Banach spaces,” Journal of Mathematical Analysis and Applications, vol 75, no 1, pp 287– 292 , 198 0 30 P Katchang and P Kumam, “An iterative algorithm for ... and variational inequality problems,” Abstract and Applied Analysis, vol 2 010, Article ID 123027, 31 pages, 2 010 20 S Saewan, P Kumam, and K Wattanawitoon, “Convergence theorem based on a new...
- 23
- 399
- 0
báo cáo hóa học:" A shifted Legendre spectral method for fractional-order multi-point boundary value problems" ppt
Ngày tải lên :
21/06/2014, 17:20
... and Engineering Academic Press Inc., San Diego, CA ( 199 9) 24 Samko, SG, Kilbas, AA, Marichev, OI: Fractional Integrals and Derivatives: Theory and Applications Gordon and Breach, Yverdon ( 199 3) ... multi-order fractional differential equations with convergence analysis Comput Math Appl 61, 30–43 (2011) 23 Vanani, SK, Aminataei, A: Tau approximate solution of fractional partial differential equations ... Bhrawy, AH, Alofi, AS, Ezz-Eldien, SS: A quadrature tau method for variable coefficients fractional differential equations Appl Math Lett 24, 2146–2152 (2011) 20 Saadatmandi, A, Dehghan, M: A new operational...
- 35
- 310
- 0
Báo cáo hóa học: " Research Article A Common Coordinates/Heading Direction Generation Method for a Robot Swarm with Only RSSI-Based Ranging" ppt
Ngày tải lên :
21/06/2014, 22:20
... propagation characteristic of wireless signal is ignored In this paper, we propose a set of common coordinates and a heading direction generation method for a robot swarm with only RSSI-based ranging ... [15] S Hara, D Zhao, K Yanagihara, et al., “Propagation characteristics of IEEE 802.15.4 radio signal and their application for location estimation,” in Proceedings of the 61th IEEE Vehicular Technology ... Vehicular Technology Conference (VTC ’06), pp 2 499 –2503, Montreal, Canada, September 2006, CD-ROM [17] R Zemek, S Hara, K Yanagihara, and K.-I Kitayama, A joint estimation of target location and...
- 11
- 289
- 0