7 habits of a highly successful trader

... write?) Reading Market Wizards I and II it was a prominent feature I noticed with all top traders. They never saw the markets as a cash box but simply as a way of operating a business. the name of the ... face the thought of making a come-back Ask these questions: * What annual rate of return do I want? * Do I want to trade full time, part time, hardly any time? * Can I handle the stress of day ... work at what really works in the market and NOT keep chasing the latest hot new trading idea that exploits peoples love of money to make them act. I am amazed at the number of traders who have...

Ngày tải lên: 13/12/2013, 00:15

... 7 Habits of a Highly Successful Trader Mark Crisp http://www.stressfreetrading.com 7. Keep trading as Part of a Balanced life: Trading be it successfully or not, is a very stressful career. ... write?) Reading Market Wizards I and II it was a prominent feature I noticed with all top traders. They never saw the markets as a cash box but simply as a way of operating a business. the name of the ... you are a long term trend follower then why ask a day trader? If you are a value investor then asking a momentum trader will be a total waste of time. What I am saying is, no two people have...

Ngày tải lên: 11/12/2013, 16:15

Ngày tải lên: 24/08/2013, 08:48

... it's not a case of reading for its own sake; it is reading carefully selected material which allows you to broaden and deepen your understanding. You will naturally be paying particular attention ... who have already internalised the opposite habit as a part of their personalities. For some people, the glass is always half-empty and the feeling of melancholy is a pleasant reminder that something ... understand the other party and do that first; finally creatively brainstorm a synergistic solution - a natural product of mutual understanding and respect. Habit 7 - Sharpen the Saw Be Proactive...

Ngày tải lên: 24/01/2014, 23:20

Ngày tải lên: 26/06/2014, 23:20

Ngày tải lên: 26/06/2014, 23:20

... inc.com http://www.inc.com/ilya-pozin /7- habits- of- web-savvy-entrepreneurs.html?nav=next 7 Habits of Web-Savvy Entrepreneurs Web-savvy people always know the latest tech trends and they can get more work done faster than ... it's time to adopt a few new habits: 1. Become an email ninja. Are you one of those people who spends more time communicating about a project than actually doing the project? Stop. Only allow yourself ... Brogan, or Guy Kawasaki, all have one thing in common. They maintain a very active blog. At the end of the day, this is where your online home base resides. If you want to succeed online, get a...

Ngày tải lên: 14/03/2014, 13:21

... zinc- metalloproteinase from Serratia marcescens. Biochim Biophys Acta 955, 77 –85. 6 Oda T, Kojima Y, Akaike T, Ijiri S, Molla A & Maeda H (1990) Inactivation of chemotactic activity of C 5a by the serratial ... 56-kilodalton protease. Infect Immun 58, 1269–1 272 . 7 Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aerugi- nosa ... arrows, A1 A5 ) in the sequence of insulin chain A. (B) Change over time in the chromatographic peak area of cleavage fragments. Note that the amount of frag- ments A1 , A2 and A4 decreases on...

Ngày tải lên: 23/03/2014, 09:20

... 2¢- and 3¢-hydroxyl groups of the adenine ribose moiety of NAD in WT PTDH, and an Arg replaced Ala 176 to stabilize the additional negative charge of NADP. PTDH-E 175 A ⁄ A 176 R displayed relaxed cofactor ... University of Illinois at Urbana-Champaign, Urbana, IL, USA 2 Department of Chemical and Biomolecular Engineering, University of Illinois at Urbana-Champaign, Urbana, IL, USA 3 Department of Biochemistry, ... cellular supply of cofactors, or the cofactors are regenerated in situ using a sacrifi- cial substrate. Several reviews discuss the available methods and benefits of regeneration of a number of cofactors...

Ngày tải lên: 23/03/2014, 15:20

... |||||||||||||||| | || ||| AcMNPV 1484 AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 1543 SpliNPV 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG 123 ||||||||||||||||||||||||||||| ... |||||||| || ||||||| AcMNPV 172 3 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT 178 1 SpliNPV 302 GTCCC-GTGATGAACCTGCACGCCGAATACAC-CACTTCGTTTGA-GAGTTTCATCGACA 358 | ||| || |||||||| ... |||||| | ||||||||| AcMNPV 1544 TGGACCCGTTTCATGGAAGACAGCTTCCCTATCGTGAACGACCAAGAAATTATGGACGTG 1603 SpliNPV 124 TTTCTAGTGGTGAACATGCGTCCCACTAGACCGAACCGTTGCTTT-AGATTTTTGGCGCA 182 || |||||| | ||||||...

Ngày tải lên: 20/06/2014, 01:20

... turkey astroviruses [22]. A bipartite NLS is characterized as hav- ing two regions of basic amino acids separated by a 10 aa spacer. The protein alignment of ORF 1a revealed that AstV-MLB1 has a sequence ... to: HAstV -1 HAstV -2 HAstV -3 HAstV -4 HAstV -5 HAstV -6 HAstV -7 HAstV -8 TAstV -1 TAstV -2 TAstV -3 ChAst V-1 OAstV MAstV 1a 78 7 28 28 NA 29 29 NA NA 29 9 9 NA 10 22 24 1b 511 54 54 NA 54 54 NA ... region of ORF 1a that has homology to a peptidase domain. In addition, alignment of AstV-MLB1 with other astroviruses revealed that AstV-MLB1 contains the amino acids of the catalytic triad (His, Asp,...

Ngày tải lên: 20/06/2014, 01:20

... Managed Account Research Inc. web site. Part II: Characteristics of a Successful Trading Plan Chapter 2: Building a Trading Plan Trader Personality and Temperament Adequate Capitalization ... Proprietary Trading Record For the active trading years of 1981–1995 (including four years when I granted power of attorney to another trader) and again starting in 20 07, my average annual rate of return ... 1. I am a real trader who trades real markets in real time with real money. I am not an academician or a person who relies on the sale of books to pay my mortgage. I am not selling a trading...

Ngày tải lên: 20/06/2014, 19:20

... The idea that chart patterns are reliably predictive of future price behavior is foolhardy at best. Charts are a trading tool, not a forecasting tool. As a trader who has used charts for market ... quick-fix systems and approaches as a means to easy profits are a dishonor to the real-life challenges of trading. Second, I want to communicate to nontraders and traders still early in their journey ... profitability that trading requires a comprehensive approach addressing far, far more than simply having a belief that a certain market is going to advance or decline. Trading is a business that...

Ngày tải lên: 20/06/2014, 19:20

... whether a trader uses a mechanical or discretionary technical approach, a supply-and-demand fundamental approach, or an economic model. Lack of certainty if a market is or is not setting up a trade ... are dictated primarily by how risk is managed. Many novice commodity traders assume each trade will be a winner. Professional traders manage their trading to assume that each trade may be a loser. Obviously, ... technical approach used by the Factor Trading Plan falls into a category known as discretionary (as opposed to the mechanical approach used by many technical traders). A discretionary trading plan...

Ngày tải lên: 20/06/2014, 19:20

... simply a means A continuation pattern during the course of a major trend allows me to advance my initial protective stop in the direction of a profitable trade. A breakout of a continuation chart ... professional trading career was dedicated to advancing a more conservative approach to futures trading. Donchian passed away in the early 1990s. The Weekend Rule basically states that a market that decisively ... graph of the Australian dollar/Japanese yen (AUD/JPY). Again note the retest that occurred two weeks after the initial pattern completion. As is almost always the case with valid pattern breakouts,...

Ngày tải lên: 20/06/2014, 19:20

... the determination of the risks and leverage taken on any trade or combination of trades, trade order management deals with the actual physical process of entering and exiting trades. My job as a trader ... me as a trader. And this is a battle that never ends. Existing Open Positions Among all aspects of my trading, this is the one area that causes me the most aggravation and stress. How to handle a ... direction. A choppy market does damage financially. Choppy markets can impose emotional and confidence consequences on a trader that are far worse. I can’t three significant weekly chart patterns that...

Ngày tải lên: 20/06/2014, 19:20