7 attach a persistent ebs volume to an instance
Báo cáo y học: "Conservative management of a grade V injury to an ectopic pelvic kidney following blunt trauma to the lower abdomen: a case report" ppsx
Ngày tải lên :
11/08/2014, 06:23
... kidney, and suggest that management of these high-grade injuries to ectopic kidneys can be treated similarly to that of kidneys in a normal anatomic position Specifically, these injuries can be managed ... vascular injuries to a segmental renal arterial branch Grade V injuries can be defined as multiple deep lacerations into the renal parenchyma resulting in a shattered kidney, as well as devascularizing ... literature suggests that many of these injuries may be managed conservatively, particularly in those who remain hemodynamically stable upon presentation Altman et al reported a series of 13 patients...
- 3
- 304
- 0
A representation theoretic approach to an eisenstein series
Ngày tải lên :
26/09/2015, 09:48
... smaller than a certain integer Furthermore, if a modular form is zero at infinity, it is called a cusp form Here “holomorphic at infinity” means an are zero for n < and “zero at infinity” means an ... for his academic guidance and patience; Prof ZHU Cheng Bo, Prof LEE Soo Teck, Mr TANG U-Liang for their kindness to answer to my questions; last but not least, my parents and friends who have been ... means that f extends to a meromorphic function at the origin A modular function is called a modular form if it is holomorphic everywhere, including at infinity This means that an are zero for all...
- 41
- 231
- 0
đồ án tốt nghiệp khoa xây dựng nhà ở 7 tầng khu công nghiệp an dương hải phòng
Ngày tải lên :
17/05/2016, 15:02
... quanh 3.Giải pháp bố trí giao thông: Giao thông theo phơng ngang mặt có đặc điểm c a phòng mở sảnh tầng, từ thang thang máy để lên xuống tuỳ ý, nút giao thông theo phơng đứng (cầu thang) Giao ... tớnh to n phõn phi ti trng ngang ta cú th coi bn sn l tuyt i cng mt phng ca nú Nh cú s khung ging ( khung,vỏch, lừi u tham gia chu ti trng ngang ), phõn phi ti trng ngang vi quan nim : thay khung ... thống c a sổ c a đi, ph a mặt đứng c a kính nên việc thông gió chiếu sáng đợc đảm bảo Các phòng đợc thông thoáng đợc chiếu sáng tự nhiên từ hệ thống c a sổ, c a đi, ban công,logia, hành lang sảnh...
- 209
- 488
- 0
Giáo án dạy ngày 2 buổi( Tuần 7 lớp A)
Ngày tải lên :
27/09/2013, 00:10
... Gi a tra n¾ng chang chang mµ ch¸u kh«ng ®éi mò th× sÏ bÞ c¶m ®Êy V× ch¸u ®i mãt l a gi a tra nh thÕ nµy? Em ®¸p: - Ch¸u tiÕc nh÷ng b«ng l a r¬i nªn tranh thđ bi tra ®i mãt l a cho ngan ¨n.Bi tra ... tØnh – thµnh : S¬n La, Lai Ch©u, §iƯn Biªn, Hµ Giang, Thanh Ho¸, NghƯ An, Qu¶ng Nam, Gia Lai, Kon Tum, B×nh D¬ng, §ång Th¸p,… Tªn c¸c danh lam th¾ng c¶nh : VÞnh H¹ Long, hå Ba BĨ, hå Hoµn KiÕm, ... víi mong íc c a anh chiÕn sÜ n¨m xa? H: Em m¬ íc ®Êt níc ta mai sau ph¸t triĨn nh thÕ nµo? GV chèt: *M¬ íc níc ta cã mét nỊn c«ng nghiƯp ph¸t triĨn ngang tÇm thÕ giíi *M¬ íc níc ta kh«ng cßn nghÌo...
- 34
- 534
- 0
Giáo án dạy ngày 2 buổi( Tuần 7 lớp A và B)
Ngày tải lên :
27/09/2013, 00:10
... tả trang phục số dân tộc Tây Nguyên :Trang phục truyền thống :nam thờng đóng khố ,nữ thờng quấn váy -HSKG :Quan sát tranh ảnh,mô tả nhà rông Tây Nguyên II) Đồ dùng: - Phiếu học tập - Tranh, ảnh ... tả trang phục số dân tộc Tây Nguyên :Trang phục truyền thống :nam thờng đóng khố ,nữ thờng quấn váy -HSKG :Quan sát tranh ảnh,mô tả nhà rông Tây Nguyên II) Đồ dùng: - Phiếu học tập - Tranh, ảnh ... việt 4) ngời Việt Nam - TL nhóm 4, báo cáo BT3: Viết hoa tên: a Bốn vị anh hùng dân tộc lịch sử n- - NX, s a sai ớc ta mà em biết b Bốn ca sĩ, nhạc sĩ,diễn viên điện ảnh (Việt Nam ) mà yêu thích...
- 19
- 490
- 0
A STUDY ON HOW TO GIVE AN EFFECTIVE APOLOGY IN ENGLISH COMMUNICATION
Ngày tải lên :
11/12/2013, 23:51
... that all parties have an area of communicative commonality They are auditory means, such as speaking, singing and sometimes tone of voice, and nonverbal, physical means, such as body language, ... never say in an Apology There‘s a right and wrong way to apologize So be careful: a badlyhandled apology is often worse than no apology at all While there is no way to guarantee that an apology ... is flat, can also make the speakers sound sarcastic Intonation This is another neglected area of language that can be usefully tied to apologies because it has more impact here than in many other...
- 51
- 1.1K
- 3
A study on how to make an effective presentation for the fourth year english major at haiphong private university
Ngày tải lên :
11/12/2013, 23:51
... changed or replaced For example, “as white as snow” (trắng tuyết) can not be changed as “as white as cotton” Idiom is syntactically anomalous It has an unusual grammatical structure For example, ... that the words in the idioms have non-standard meaning Thus, in this analysis, we assume that these idioms, known as semantically decomposable idioms, can be paraphrased in a way that assigns a ... interactions with native speakers Since there are thousand of idioms in any language with native speakers Since there are thousands of idioms in any language, people may want to devote attention to...
- 51
- 853
- 0
A STUDY ON HOW TO MAKE AN EFFECTIVE PRESENTATION FOR THE FOURTH YEAR ENGLISH MAJORS AT HAIPHONG PRIVATE UNIVERSITY
Ngày tải lên :
11/12/2013, 23:51
... relatively easy to tabulate and analyze” (Richards, 2001:60) They can be seen as a useful tool for “providing participants’ personal details, educational background, and previous language learning ... communicate effectively is a vital skill in the business world and the community at large A person who can speak and present clearly and persuasively has a unique advantage over one who cannot ... information and promoting ideas Presentations are a form of communication, and if we can communicate effectively presentations cease to be difficult” (Andreja Tonc, 2002:7) “In today’s business and...
- 85
- 1.2K
- 8
A study on how to write an effective cause and effect essay in english
Ngày tải lên :
11/12/2013, 23:51
... persuasive essay will be organized in one way and an expository essay in another way (Oshima, A, 2007: 01) An overview on essay 2.1 What is an essay? According to Oshima, Alice and Hogue Ann (2004:16)– ... grammar (grammatical structures) but also plentiful source of vocabulary to write a paragraph as well as an essay completely Many learners think that when they can speak well, they will automatically ... final]) When you are analyzing causes that are not of equal importance or that are immediate and remote, it is generally a good idea to organize the paragraphs beginning with the immediate and...
- 53
- 967
- 2
Tài liệu Converting a DataSet to an ADO Recordset docx
Ngày tải lên :
14/12/2013, 18:16
... ""; xmlDoc.LoadXml(adoXml); // Create a namespace manager for the XML document XmlNamespaceManager nm = new XmlNamespaceManager(xmlDoc.NameTable); // Add ADO prefixes nm.AddNamespace("s", "uuid:BDC6E3F0-6DA3-11d1 -A2 A3-00AA00C14882"); ... // Load the Orders data into a table in a DataSet DataSet ds = new DataSet( ); SqlDataAdapter da = new SqlDataAdapter(sqlText, ConfigurationSettings.AppSettings["Sql_ConnectString"]); da.Fill(ds, ... schema section and the data section The schema section is required and contains detailed metadata about each column in the table The data section contains an element for each row Column data is stored...
- 15
- 390
- 0
Tài liệu Lab 5.2.7 Establishing a Console Connection to a Router or Switch docx
Ngày tải lên :
21/12/2013, 19:15
... serial or COM1 It may or may not be identified Step Locate the RJ-45 to DB-9 adapter One side of the adapter connects to the PCs serial interface and the other to the RJ-45 rollover cable connector ... connectors a Examine the router or switch and locate the RJ-45 connector labeled “Console” Step Identify the computer serial interface, which is COM or a It should be a or 25-pin male connector labeled ... serial interface on the PC or dumb terminal is a DB-25, an RJ-45 to DB-25 adapter will be needed Both of these adapters typically come with a Cisco router or switch Step Locate or build a rollover...
- 6
- 476
- 0
Tài liệu Exporting the Results of a Query to an Array pdf
Ngày tải lên :
26/01/2014, 10:20
... (rowCount >= 0) nRows = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection ... the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the names ... = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected...
- 5
- 309
- 0
![Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc](https://media.store123doc.com/images/document/14/br/vp/medium_vpv1392870032.jpg)
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
Ngày tải lên :
20/02/2014, 11:20
... DNA was then transferred to a nylon membrane and TPP moieties covalently attached to the DNA were visualized using anti-TPP serum (B and D) The mitochondrial incubation with mitoDC-81 was repeated ... (i.e a standard DNA ÔladderÕ used as a molecular weight marker) After incubation the DNA was separated by electrophoresis, electrotransferred to a nylon membrane and probed for mitoDC-81 covalently ... with ClaI (C and D) DNA was separated by electrophoresis on an agarose gel and the ethidium bromide fluorescence recorded to quantify DNA (A and C) The DNA was then electrotransferred to a nylon...
- 10
- 638
- 0
Báo cáo khoa học: "Exploring Deterministic Constraints: From a Constrained English POS Tagger to an Efficient ILP Solution to Chinese Word Segmentation" ppt
Ngày tải lên :
07/03/2014, 18:20
... 47th Annual Meeting of the ACL and the 4th International Joint Conference on Natural Language Processing of the AFNLP, ACL ’09, pages 513–521 Mitch Marcus, Beatrice Santorini, and Mary Ann Marcinkiewicz ... AAAI, pages 412–418 C Kruengkrai, K Uchimoto, J Kazama, Y Wang, K Torisawa, and H Isahara 2009 An error-driven word-character hybrid model for joint chinese word segmentation and pos tagging ... words are generated with respect to the partially tagged character sequence A character tagged with B always occurs at the beginning of a possible word Table illustrates the constrained and raw...
- 9
- 425
- 0
A Beginner’s Guide to Network Security: An Introduction to the Key Security Issues for the E-Business Economy doc
Ngày tải lên :
14/03/2014, 22:20
... patient, or human resources data, are far more serious, can be damaging to reputations, and can cause financial liability for a company What can these enemies do? Viruses Viruses are the most widely ... date and, ideally, are all protected by the same anti-virus package—if only to keep maintenance and update costs to a minimum It is also essential to update the software itself on a regular basis ... network attacks have been documented, and they are commonly classified in three general categories: reconnaissance attacks, access attacks, and denial of service (DoS) attacks • Reconnaissance attacks...
- 9
- 665
- 0
A Manager’s Guide to Leadership An action learning approach 2nd edition
Ngày tải lên :
17/03/2014, 21:29
... for an organisation? We have learned that organisational design is no science There are too many variables and dilemmas for any rational solution A strong design brings clarity and can make organisational ... guide to action So use it to pick and choose, pick and mix, and to take from it whatever you want and can apply Pedler01v3_01 20/04/10 14:40 Page Leadership: what is it and are you part of it? Making ... 20/04/10 14:40 Page 11 Leadership: what is it and are you part of it? Making MAJOR CHANGE Developing DIRECTION AND STRATEGY Creating a LEARNING ORGANISATION New ORGANISATIONAL STRUCTURES Managing MERGERS...
- 334
- 551
- 0
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx
Ngày tải lên :
18/03/2014, 01:20
... forward primer D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢) and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; ... D11-13 mutant; forward primer F1 (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse primer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPTB-NLD-I ... is unusually longer (30 amino acids) than that of other well characterized bipartite NLSs (Table 1) Searching SWISSPROT and standard databases by PROSITE, and analyzing data deposited at the PredictNLS...
- 8
- 1.1K
- 0
SCIENCE FOR CONSERVATORS Volume 1 An Introduction to MATERIALS Conservation Science Teaching Series pot
Ngày tải lên :
23/03/2014, 01:20
... metal blade Having looked at the means of making increasingly specific and detailed identifications and analyses of materials, look again at the chart and in particular at the two large rectangles ... animals or plants Coal and fuel oil are both derived from fossilised plants and animals.) There are, too, both natural and artificial inorganic materials For example, the pigment vermilion can ... rectangles marked inorganic that stone, metal, ceramics and glass are all derived from rocks and/ and organic You will perhaps already be familiar with the idea or minerals and are termed inorganic...
- 110
- 509
- 0
Báo cáo khoa học: "A Dynamic Bayesian Framework to Model Context and Memory in Edit Distance Learning: An Application to Pronunciation Classification" ppt
Ngày tải lên :
23/03/2014, 19:20
... R.C Wison, and E.R Hancock 2000 Bayesian graph edit distance IEEE Trans on Pattern Analysis and Machine Intelligence, 22:628–635 M Neuhaus and H Bunke 2004 A probabilistic approach to learning costs ... and H Ney 2003 A novel string -to- string distance measure with applications to machine translation evaluation In Machine Translation Summit IX, pages 240–247 V Levenshtein 1966 Binary codes capable ... problems such as machine translation can benefit from a Graphical Models perspective Machine translation presents a fresh set of challenges because of the large combinatorial space of possible alignments...
- 8
- 397
- 0