6 23 improper integrals depending on a parameter uniformconvergence

... Partial Fraction Expansion of Rational Functions 584 Application of Residues to Evaluation of Real Integrals 587 Definition of Conformal Mapping 59 Examples of Conformal Mapping 594 Applications ... Introduction 65 9 Review of Equation for Forced Vibrations of a Spring 64 6 65 9 66 Case of Two Particles 66 2 Case of N Particles 66 8 Continuous Medium Fundamental Partial Differential Equation 67 4 Classification ... Classification of Partial Differential Equations w Basic Problems 67 6 The Wave Equation in One Dimension Harmonic Motion 67 8 Properties of Solutions of the Wave Equation 68 1 68 5 The One-Dimensional...

Ngày tải lên: 31/03/2014, 15:27

... there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction principle ... solutions of two functional inequalities and converses to contraction theorems, Bull Polish Acad Sci Math 51 (2003), no 2, 147–1 56 C Petalas and T Vidalis, A fixed point theorem in non-Archimedean ... proofs of Theorems 3, 4, and 5] on connections between some nonlinear contractive conditions, [7, 8] on converses to contraction theorems, [5, Example 1] concerning a comparison of two fixed point...

Ngày tải lên: 23/06/2014, 00:20

... over laparoscopy for evaluating pelvic and extraperitoneal diseases, as well as lesions concealed by adhesions excision and was involved in editing the manuscript All authors read and approved ... with metaplasia of the mucinous type and extravasation of the mucinous secretion into the adjacent stroma Majority of these cases occurred secondary to surgical, commonly laparoscopy, scars An umbilical ... deliveries and had no history of abdominal pain, dyspareunia or infertility She was not using any form of hormonal contraception Her medical history was not significant and she never had any abdominal...

Ngày tải lên: 11/08/2014, 14:21

... CM, Chavarria C: Painful tongue lesions associated with a food allergy s.l.: Pediatr Dent 2001, 23 (6) :5 06- 7 Hussein Gadban, Peter Gilbey, Yoav Talmon, Alvin Samet: Acute edema of the tongue: a life-threatening ... Martínez Alonso JC, Melgosa Callejo A, Fuentes Gonzalo MJ, Martín Garc a C: Fixed drug eruption on the tongue due to clarithromycin s.l.: Contact Derm 2005, 53(2):121-2 Kamata Y, Iwamoto M, Kamimura ... contributions OA examined the patient, provided accurate management and arranged the initial case presentation report CD provided the references and amended the presentation Consent Discussion...

Ngày tải lên: 11/08/2014, 23:21

... questionnaire and disability pension data derived from DREAM among the 4177 persons categorized as 18-45 year old employees at baseline Outcome A disability pension case was defined from onset ... (OR=3.13) than among women (OR=2.19) (Table 2) Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase in disability pension risk ... Social Affairs and the Ministry of Education DWECS was conducted in 1990, and featured a random sample drawn from the Central Population Register of Denmark of 965 3 people aged 18-59 Of these, 866 4...

Ngày tải lên: 26/10/2012, 10:03

... There was a wide inter-hospital variation for the OAAICD/EPI because of a wide variation in epidural and cesarean components of OAAI (Figure 2) In 2005, median OAAICD/EPI was 0.88; range 0.45 (60 % ... variation in epidural and cesarean delivery rates in Israeli hospitals is reflected in the contributions of epidural analgesia and cesarean anesthesia to the total OAAI in individual hospitals ... this was not the only factor found to determine demands for obstetric anesthesia workload Our data revealed a remarkably wide variation in the rates of epidural labor analgesia and cesarean delivery...

Ngày tải lên: 05/03/2014, 15:20

... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites ... localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda...

Ngày tải lên: 06/03/2014, 01:20

... autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; ... 270, 69 75– 69 83 Osada, S., Daimon, S., Ikeda, T., Nishihara, T., Yano, K., Yamasaki, M & Imagawa, M (1997) Nuclear factor family proteins bind to the silencer element in the rat glutathione transferase ... Kaczmarek, L., Calabretta, B., Chen, S.-T & Baserga, R (1987) Molecular cloning of a cDNA for a human ADP/ATP carrier which is growth-regulated J Biol Chem 262 , 4355–4359 Barath, P., Luciakova,...

Ngày tải lên: 07/03/2014, 15:20

... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and ... 5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers 2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers 3, forward: 5¢-ACCAGATGGTGAGAGCGAT-3¢, and reverse: 5¢-CTGTCTTTCATAGGTCCCAAT-3¢ ... RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢;...

Ngày tải lên: 22/03/2014, 16:20

... other variables and factors available Thus overall, the damage factor had both a statistical and a causal value, i.e functional and more precisely morphogenetic This confirmed the relevance of taking ... damage Finally, for each of the years following the frost, a one way analysis of variance was used to compare annual growth depending on the level of damage 3.2 Forking frequency Table Ia demonstrates ... general impression of severe damage Conversely, this experimental method has the advantage of allowing one to bypass the frost itself in a way, as its characteristics are always difficult to define accurately...

Ngày tải lên: 07/08/2014, 16:20

... Aikawa M, Ishii T, Nonaka K, Nakao M, Ishikawa K, Arai S, Kita H, Miyazawa M, Koyama I, Motosugi U, Ban S: A case of gastric xanthogranuloma associated with early gastric cancer Nippon Shokakibyo ... Department of Surgery, Naga Municipal Hospital, 1282, Uchita, Kinokawa, Wakayama 64 9 -64 14, Japan 2Department of Pathology, Naga Municipal Hospital, Japan Authors’ contributions HK did the literature ... Radiol 20 06, 16: 237 1 -237 2 Kubosawa H, Yano K, Oda K, Shiobara M, Ando K, Nunomura M, Sarashina H: Xanthogranulomatous gastritis with pseudosarcomatous changes Pathol Int 2007, 57:291-295 Aikawa...

Ngày tải lên: 09/08/2014, 02:20

... Misra NC: Bladder teratoma: a case report and review of literature Indian J Cancer 1997, 34:20-21 Agrawal S, Khurana N, Mandhani A, Agrawal V, Jain M: Primary bladder dermoid: a case report and ... Urol 1 961 , 85:7 96- 799 Sabnis RB, Bradoo AM, Desai RM, Bhatt RM, Randive NU: Primary benign vesical teratoma A case report Arch Esp Urol 1993, 46: 444-445 Misra S, Agarwal PK, Tandon RK, Wakhlu AK, ... processed and read the slides with AAO and DBM who are pathology residents LIO conceived the idea for this publication All authors read, appraised and approved the final manuscript Acknowledgements...

Ngày tải lên: 11/08/2014, 10:23

... underwent a surgical exploration of his popliteal artery under general anaesthesia through a posterior approach that allowed adequate exposure of the popliteal artery and cysts Evacuation of all three ... later, with claudication of the same (right) limb occurring at a distance of more than half a mile and after exercise A repeat Duplex scan demonstrated that his popliteal artery was widely patent ... patient’s magnetic resonance imaging scan The sagittal image on the left demonstrates one cyst in the posterior wall of the popliteal artery and a further anterior wall cyst causing stenosis The axial...

Ngày tải lên: 11/08/2014, 12:20

... articulation Nguyen et al [8] reported a case series where one patient had one phalanx and one pseudoarticulation, and two other cases with three bony segments and two pseudoarticulations A similar configuration ... ossificans, avulsion, heterotopic bone formation, Fong's disease and osteochondroma Fong's disease (onychoosteodysplasia) is a hereditary condition with dysplastic or absent nails and absent ... literature For example, Lame [5] and Granieri and Bacarini [7] described a total of six cases, all consisting of a bony structure of at least two bony elements and at least one (pseudo-) articulation...

Ngày tải lên: 11/08/2014, 17:21

... examination revealed general poor health but pulmonary and cardiac examinations were unremarkable and the patient was afebrile Laboratory investigations were normal with the exception of anemia, ... cystoprostatectomy years earlier and had also had an endovascular stent-graft repair of an infrarenal abdominal aortic aneurysm The patient complained of abdominal pain in his right flank A physical ... negative for acidfast bacilli stains Antitubercular treatment with isoniazid 300 mg/day, rifampicin 60 0 mg/day and ethambutol 1200 mg/day was administered for months maintaining isoniazid and...

Ngày tải lên: 11/08/2014, 17:21

... echocardiographic evaluation seems also to be a cost-effective approach, as it provides unique information that can significantly impact on patient management decisions Abbreviations AMI: acute myocardial ... ten patients with DMR and concluded that advanced age (mean age 69 years), absence of history of coronary artery disease (90%), anterior AMI (60 %), arterial hypertension (60 %), and male sex (male/female ... whereas the anterior wall appeared hypokinetic and the apex akinetic A coronary arteriography performed on the same day showed a total occlusion of the LAD branch in its proximal part along with an...

Ngày tải lên: 11/08/2014, 23:21

... laparoscopic salpingotomy with saline irrigation, image-guided aspiration and/or drainage [8,9] to salpingectomy The latter should be considered as last resort in premenopausal females Repeat laparoscopy ... transvaginal drains and the effect of intra-fallopian antibiotic instillation on fertility still remains unclear One possible way to assess fertility is by performing a repeat diagnostic laparoscopy ... irrigated generously with a 0.9% saline and Betadine mixture Microbiological analysis of the pus revealed Escherichia coli and anaerobes but not Chlamydia or Candida spp A postoperative Gastrografin...

Ngày tải lên: 11/08/2014, 23:21

... RIPA buffer (50 mM Tris-Cl; pH 7.5, 1% NP-40, 0.05% SDS, 150 mM CGAGATCCGTTCACTAATCGAATG B GGATTAACTGCGAATCGTTCTAGC C CGAGATCCGTTCACTAATCGAATG BA1 (b-actin) CATGTGCAAGGCCGGCTTCG BA4 (b-actin) GAAGGTGTGGTGCCAGATTT ... lower panel) Reactions without RT are shown to demonstrate lack of DNA contamination (lanes 5-8) Water (mock) was used as control of DNA contamination in the reaction C) Quantitative analysis ... siGENOME SmartPool (UAGAUGAACUGAGUCGUUA, GACCAGGCCAGUAACAUUU, ACCCA GUGCUUGAUUAUGA, CCAGUGAGAGUUCAUUU AU), siGENOME Non-Targeting siRNA Pool #1 Either HeLa cells or 293T cells were transfected...

Ngày tải lên: 13/08/2014, 01:21

... Domains (CDD) databases (Figure 2a; Additional data file 2) Components of canonical signaling pathways were included (for example, Ca2+, cAMP, and ERK), as well as less characterized and putative ... Jr, Aponte AM, Shen RF, Balaban RS, Finkel T: The mammalian target of rapamycin (mTOR) pathway regulates mitochondrial oxygen consumption and oxidative capacity J Biol Chem 20 06, 281:2 764 3-2 765 2 ... directly estimated from the relevant data set with no need to assay in parallel a large population of identical d-siRNAs For each average F score from each d-siRNA, the calculated CAsH parameter then...

Ngày tải lên: 14/08/2014, 07:22

... Multilateral Investment Guarantee Agency MNC Multinational Corporations NAFTA North American Free Trade Agreement NAICS North American Industrial Classification System NBS National Bureau of Statistics ... International Standard Industry Classification ISO International Organization for Standardization LDC Less Developed Countries MAI Multilateral Agreement on Investment MFN Most-Favored-Nation MIGA ... in China 307 x List of Symbols APEC Asian and Pacific Economic Cooperation APL Administrative Procedure Law of PRC (1989) ASEAN Association of Southeast Asian Nations ASRCC Annual Statistics...

Ngày tải lên: 14/09/2015, 18:30