5 naotoshi seo tutorial opencv haartraining rapid object detection with a cascade of boosted classifiers based on haar like features http note sonots com scisoftware haartraining html
rapid object detection using a boosted cascade of
Ngày tải lên :
24/04/2014, 13:29
... essentially that of a degenerate decision tree Our object detection framework Feature Evaluation Haar Basis Functions Haar Basis Functions Integral Image Integral Image Haar Basis Functions Haar Basis ... Basis Functions Original Image Haar Basis Functions Haar Basis Functions In order to computing features rapidly at many scales Large # of features Cascaded Classifiers Structure Cascaded Classifiers ... Image A learning algorithm( Based on AdaBoost [5] ) Select a small # of visual features from a larger set Select a small # of visual features from a larger set yield an efficient classifiers yield an...
- 35
- 478
- 2
OpenCVs Rapid Object Detection
Ngày tải lên :
11/06/2014, 15:49
... by statues of live video Several sites with different floor surfaces and illuminations have been taken to achieve a variety of conditions Additionally at each site the camera was positioned in ... OpenCV' s Rapid Object Detection Step - Preparation Tools: First of all the utilities "createsamples.exe", "haartraining. exe" and "performance.exe" should be available In our case we work ... have to be “packed” into a vec-file in the folder “data” This can only be done by the createsamples tool, even if you already have a set of object images and don’t want to generate artificial...
- 6
- 148
- 0
Báo cáo khoa học: " A simple and rapid Hepatitis A Virus (HAV) titration assay based on antibiotic resistance of infected cells: evaluation of the HAV neutralization potency of human immune globulin preparations" potx
Ngày tải lên :
12/08/2014, 04:21
... http: //www.virologyj .com/ content /5/ 1/ 155 Figure Determination of the HAV neutralization potency of human IG preparations by ARTA Determination of the HAV neutralization potency of human IG preparations by ARTA HAV-Bsd ... a more direct evaluation of the potency of the IG preparations We used the ARTA to evaluate the HAV neutralization potency of two commercially available IG preparations and a WHO anti-HAV standard ... cutoff indicating the absence of anti-HAV antibodies Evaluation of anti-HAV neutralizing antibodies in the human IG preparations by ARTA The HAV neutralization potency of the IG preparations was...
- 9
- 297
- 0
Object detection with sector scanning sonar
Ngày tải lên :
01/10/2015, 17:27
... sector scanning sonar over a multibeam sonar are: Data The data output for a sector scanning sonar for each bearing ensonification is an array, with its array size dependent on a configured range ... along a scaling constant The scaling constant was estimated based on a desired probability of false alarm Several other CFAR variants such as Cell Averaging CFAR (CA-CFAR), Introduction Smallest Of ... detection for STARFISH AUVs The reasons are because of its compact size, lower power consumption and lower data rates Upon successful hardware and software integration of the sector scanning sonar with...
- 143
- 423
- 0
5 bước SEO từ khóa lên top Google docx
Ngày tải lên :
12/03/2014, 07:20
... dễ nhận biết – Ví dụ :http: //domaincuaban .com/ iphone -5/ can ai-Ha-Noi .html c Đảm bảo bạn bạn view-source trang đích bạn thấy thẻ , khơng có thẻ này, từ kh a bạn lên chậm d Đảm ... giá rẻ” ” kem dưỡng da nhập khẩu” để SEO thay từ kh a có độ dài từ – chữ “iphone 5 , “kem dưỡng da” độ canh tranh từ kh a – chữ thấp thời gian lên Top nhanh nhiều so với từ kh a từ – chữ hiệu tỉ ... cơng cao nhiều thứ mà người dùng cần b Chọn l a từ kh a có tính đ a phương - Nếu bạn kinh doanh vài tỉnh thành điều tốt, bạn nên thêm từ kh a đ a phương sau từ kh a ví dụ “bán iphone xách tay Hà...
- 12
- 559
- 2
5 cách Seo Local giết chết thứ hạng của bạn ppt
Ngày tải lên :
12/03/2014, 07:20
... Làm danh sách có đ a cũ cách tìm kiếm đ a Google sau cập nhật đ a bạn Làm tương tự việc thay đổi số điện thoại Đảm bảo danh sách kinh doanh bạn phù hợp directories Cùng tên, số điện thoại đ a xác ... xác 2 Khơng có đ a trang web Không biết lý nhìn thấy nhiều trang web local khơng liệt kê đ a Tơi cho cơng ty ch a có trụ sở riêng Trong hầu hết trường hợp, bạn nên liệt kê đ a nhà văn phòng Nếu ... có Meta Titles mơ tả Phần quan trọng trang web để seo tốt Meta Titles bạn Nếu bạn khơng biết gì, gọi công ty chuyên thiết kế web để seo, yêu cầu họ kiểm tra tư vấn cho bạn Đây yếu tố quan trọng...
- 5
- 263
- 1
5 Lỗi seo nghiêm trọng có thể phá hủy vị trí xếp hạng của website pptx
Ngày tải lên :
20/03/2014, 22:20
... làm cho a dạng h a anchortext baclink Về chất có anchortext phong phú tốt, khơng nên q nhiều Cá nhân cố gắng giữ biến thể anchor text duới 10% backlink tơi Sai lầm thứ 2: Bỏ qua trang nội Khi ... nhiều backlink tăng thứ hạng trang chủ Đó cơng cụ tìm kiếm khơng xếp hạng vị trí website bạn d a tảng page-by-page mà đánh gia tổng thể tồn website Đó lí trang web About .com hay Wikipedia đuợc ... title meta description nhân tố quan trọng để tăng traffic convertion cho bạn Duới kĩ thuật đơn giản để tối ưu tititle meta description Thẻ title phải không trùng với trang có mạng nên ch a 56 ký...
- 11
- 371
- 0
Top 5 mẹo SEO không thể thiếu cho người làm seo pdf
Ngày tải lên :
04/04/2014, 07:20
... dựng-trong-springfield 2) Đ a từ kh a bạn thẻ tiêu đề, Meta Tags Alt Tags trang web bạn Một lần điều giúp cơng cụ tìm kiếm nhận từ kh a trang web bạn 3) Kết hợp từ kh a bạn vào nội dung thể văn trang ... trở lại tốt bạn nhận từ trang web có ch a thơng tin liên quan đến lĩnh vực kinh doanh bạn bạn nhận liên kết từ trang web có ch a từ kh a bạn, bạn có khởi đầu tuyệt vời 5) Phân tích nơi người truy ... khuyên SEO hàng đầu tơi: 1) Sử dụng từ kh a bạn tên miền bạn - Để có kết lam SEO tốt bạn nên chọn tên miền cho trang web bạn bao gồm từ kh a bạn Điều giúp từ kh a bạn ý cơng cụ tìm kiếm Ví dụ, bạn...
- 4
- 386
- 0
Rapid GUI Development with QtRuby phần 5 pps
Ngày tải lên :
24/07/2014, 02:20
... order to automate tasks See Section 5. 5, Signals and Slots, on the following page for more details gram to see just how easy using them really is In order to take advantage of the automation, we ... find that Qt’s signals and slots are very similiar to delegates from that language of signals and slots can be harnessed to create dynamic applica- BOOKLEET © Report erratum 47 C HAPTER T AKE THE ... String automatically, the definition of signals, slots, and the connection of the two must utilize the Qt style syntax This is a QtRuby limitation, and is anticipated to be fixed in a later release of...
- 11
- 225
- 0
5 cách SEO hiệu quả Google Plus mà bạn cần biết ngay
Ngày tải lên :
29/07/2014, 21:00
... điền đầy đủ profile bạn hình minh h a, giúp bạn tận dụng tối a tiềm SEO Google+ Hình ảnh trích dẫn từ socialmediaexaminer .com HÌnh ảnh hiển thị trang kết tìm kiếm Bạn cần tối ưu h a 55 kí tự phần ... ảnh trích dẫn từ socialmediaexaminer .com Vậy làm để có thêm nhiều nguời follow Tận dụng mạng xã hội mà bạn tham gia facebook, zingme, linkhay để chia sẻ google+ profile page bạn tới bạn bè ... liên kết nội dung với profile đoạn mã sau: le Dung Thay profile_url url trang Google+ bạn Sau đăng nhập tài khỏan google+ chọn edit profile add website blog tới phần contributor Có lưu ý với...
- 5
- 333
- 0
Báo cáo y học: "Rapid identification of PAX2/5/8 direct downstream targets in the otic vesicle by combinatorial use of bioinformatics tools" ppt
Ngày tải lên :
14/08/2014, 21:20
... AACTGCCATGTGCGCAGTGAAGGGTTAATCAGATCAATAGACTGA metrnl GAACAGAAATAACACACTGAAGCTTGTCCCAGATGACCCAAATTC sec31l AGCTGGTAGAAGGTCACTGAAGCTTAAATACAGGTTTTCCAATTC cldn7 TAGGGAGGACGGAACAGTGAGGCGTGACAGAGTGCACAGCAATTG ... 5' gggAGCTGGTAGAAGGTCACTGAAGCTTAAATACAGGTTTTCCAATTC; brn2 Xenopus tropicalis promoter, 5' gggAACTGCCATGTGCGCAGTGAAGGGTTAATCAGATCAATAGACTGA; metrnl zebrafish promoter, 5' gggGAACAGAAATAACACACTGAAGCTTGTCCCAGATGACCCAAATTC; ... regions up to 40 bp and an additional 5' GGG overhang for labeling: cldn7 human promoter, 5' gggTAGGGAGGACGGAACAGTGAGGCGTGACAGAGTGCACAGCAATTG; sec31l human promoter, 5' gggAGCTGGTAGAAGGTCACTGAAGCTTAAATACAGGTTTTCCAATTC;...
- 11
- 297
- 0
2.topcased 2.5 uml editor tutorial
Ngày tải lên :
18/10/2014, 16:38
... as an image Add a diagram Adjust the structure of the model Validate a model Specialization of items – UML profile Navigation in the diagrams Version management of models Collaborative management ... case 19 Topcased UML editor Tutorial Add a diagram (3/3) • Other shortcuts : to add an activity diagram or a state machine diagram to a CallBehaviorAction Automatic association to current diagram ... Topcased UML editor Tutorial Version management of models (4 /5) • 39 Operations of version management available for each model Contextual menu « Team » : Synchronize, commit, update, … Contextual...
- 53
- 227
- 0
5 mẹo SEO ảnh để tăng truy cập từ công cụ tìm kiếm
Ngày tải lên :
04/12/2015, 03:53
... đặt tên cho hình ảnh 123.jpg hay Image-1.jpg Thay vào đó, đặt tên phù hợp với nội dung ảnh ch a ảnh Ví dụ: hình ảnh viết nên đặt tên "meo -seo- cho-anh" "seo- tips-for-images" Hãy giữ giới hạn từ cho ... nay, có hàng ngàn webmaster blogger đấu tranh để có thị phần truy cập nhiều vào website họ Hầu hết blogger tối ưu h a nội dung trang web nhà cung cấp blog hỗ trợ Họ công đầu tư để đ a từ kh a ... Thêm thẻ Alt Title phù hợp cho ảnh Alt Title thuộc tính HTML tag ảnh, chúng cung cấp thơng tin cho cơng cụ tìm kiếm phân loại ảnh Phần mô tả cần ngắn đầy đủ ý Kích thước ảnh Đây yếu tố quan trọng...
- 5
- 133
- 0
seo tutorial
Ngày tải lên :
28/08/2016, 12:19
... content Nowadays, search engines have become very smart and they are able to understand complete grammar and complete phrase Hence while ranking a page against other, the content available on ... created Here are the links to validate your web pages: Validate HTML/ XHTML File against W3C Standard HTML/ XHTML Validator Validate CSS File against W3C Standard CSS Validator While verification, ... Disclaimer, Privacy Policy pages on mandatory basis 32 SEO Create a homepage link to each and every webpage and provide easy navigation through all the pages Pay attention to your dynamic page...
- 39
- 271
- 0
Journal of Business Case Studies – November/December 2009 Volume 5, Number 6 13 An Apparel Brand‘s Channel Strategy: The Case of Oliver in Korea
Ngày tải lên :
17/04/2013, 20:23
... unethical behaviors and to attempt to develop a healthy relationship with apparel brand suppliers Those changes are as follows; Adjusting Commission Rates, Depending on Sales Volume of Apparel Brand ... indicated that the portion of infants and children‘s wear has been on the increase in Korea‘s fashion market As presented in Table 2, infant and children‘s wear took 36.8% of the total fashion market ... multiple consideration factors in channels of distribution management, this case is recommended as a comprehensive case An undergraduate course instructor may also use this case for an end-ofchapter...
- 10
- 729
- 1
Chương II - Bài 5: Hệ số góc của đường thẳng y = ax + b (a khác 0)
Ngày tải lên :
23/06/2013, 01:25
... α = 56 0B y = ax + b ta làm nào? Bài 29 SGK T59 a) Do cắt trục hoành điểm có hoành độ 1 ,5 nên ta có giao điểm laø (1 ,5 ; 0) Thay (1 ,5 ; 0) vaø a= vào hàm số : Gọi HS Xác đònh hàm soá y = ax + ... số a= qua điểm (1; +5) nên : GV: hướng dẫn HS vẽ đồ thò hàm số Thay (1 ; +5) a = vào hàm số : y = ax + b ⇔ ? Để vẽ đồ thò hàm số ta thực bước nào? +5 = + b ⇒b = Vậy hàm số cần tìm : y= x +5 HS: ... HS S a sai (nếu có ) x 13 C ; ÷ 5 B (2 ,5 ; 0); B 13 262 + 132 4+ ÷ + ÷ = 52 AC = 13 = 8 45 = 5 d) Gọi góc tạo đường thẳng (1) với O x α , (2) với O x β Ta có : CAD =...
- 9
- 14.9K
- 30
Chương II - Bài 5: Hệ số góc của đường thẳng y = ax + b (a khác 0)
Ngày tải lên :
24/06/2013, 01:26
... đường thẳng y = ax + b (a ≠ 0) Kh¸i niệm hệ số góc đường thẳng y = ax + b ( a ≠ 0) a, Gãc t¹o bëi đường thẳng y = ax + b trục Ox y y T T y = b y= + ax + b ax A α o a> 0 x o α A x ao góc nhọn a a ... -3x + a, Vẽ đồ thị hàm số b, Tính góc tạo đường thẳng y = -3x + trục Ox ( làm tròn đến phút) Để tính góc góc hợp đường thẳng y = ax+b (a ≠ 0)vµ trơc Ox ta lµm nh sau: + NÕu a > tgα = a tõ ®ã...
- 12
- 1K
- 10
Tài liệu Zend PHP 5 Certification Study Guide - By Davey Shafik with Ben Ramsey docx
Ngày tải lên :
15/12/2013, 12:15
... operation like an addition can have catastrophic consequences on the reliability of your application Most importantly, you need to be aware that the float data type is not always capable of representing ... to variables, constants are meant for defining immutable values Constants can be accessed for any scope within a script; however, they can only contain scalar values Constant names, like variables, ... 143 1 45 146 147 148 149 150 151 152 153 154 154 155 157 157 158 159 160 161 x ” CONTENTS The ActiveRecord Pattern The Standard PHP Library Accessing Objects as Arrays Simple Iteration...
- 278
- 362
- 1
Tài liệu Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 5) doc
Ngày tải lên :
22/01/2014, 00:20
... of compounds to be analyzed Various combinations of a mobile phase with a separation column, almost every inorganic ion (anions and cations) can be detected and quantitated IC for inorganic ions ... instruments are much higher than that of a usual HPLC An IC system consists of a pump, an ion-exchange separation column, a suppressor, a conductivity detector and a workstation for integration and data ... ng to several µg on a plate Recently, TLC plates coated by stationary phases with small and uniform particles (4 .5 5 µm diameter) have became commercially available [6]; these plates are superior...
- 11
- 356
- 0
Assessing and Managing Rapid Credit Growth and the Role of Supervisory and Prudential Policies docx
Ngày tải lên :
06/03/2014, 08:20
... Estonia, and Lithuania; horizontal exchange rate bands in Hungary and Slovenia; fixed exchange rates in Latvia, Macedonia, and Ukraine; crawling bands in Belarus and Romania; and tightly managed ... Poland Macedonia Bosnia Slovenia Romania Croatia Hungary Moldova Estonia Belarus Russia Lithuania Albania Bulgaria -10.0 Latvia Ukraine 0.0 -20.0 Real Growth of Private Sector Credit Private ... 2000-2004) 40 Ukraine 30 Albania Latvia Bulgaria Real Growth of Credit Lithuania Russia Belarus Moldova 20 Hungary Croatia Estonia Romania 10 Slovenia Bosnia Macedonia Poland Czech Republic Slovak Republic...
- 59
- 502
- 0