... wear, have a threaded insert made from a special nylon The threaded drive nuts (3) in the mold blocks are made of brass grade 2. 055 0 All guiding and wear components have been treated with Lamcoat@ ... of the narrow ends, there is a tapered surface extending inward from the rim at an angled of 45 The adjacent rib has a similarly angled surface that a single slide (l), to which two detail inserts ... cavities are oriented in such a manner The mold is filled via a sprue bushing that feeds a short runner leading to a narrow edge gate located midway along each part Part Release/Ej ection 95...
Ngày tải lên: 29/04/2016, 13:51
... Hausman Marketin g Letter Orig in al article Connect: Author ed by: Dr Angela Hausman Hey, I'm Dr An g ela Hausman I'm a marketin g professor at Howard Un iversity an d run a full service marketin ... ewsfeeds Make a ch aritable don ation for each Facebook Like It makes you look GOOD an d en courag es sh arin g For example, Pedig ree don ated a bowl of dog food to a pet sh elter for each Facebook ... ood corporate citizen sh ip, tradition al advertisin g , product placemen t th at reson ates with your targ et audien ce an d auth en tic social media marketin g strateg ies Provide valuable ten...
Ngày tải lên: 08/02/2014, 09:36
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx
... the constant velocity and constant force SMD Acknowledgements We are grateful to Sergi Garcia-Manyes for careful reading of the manuscript and Pallav Kosuri for assistance in figure preparation ... Silicon-nitride cantilevers (Veeco, Santa Barbara, CA) were calibrated for their spring constant using the equipartition theorem The average spring constant was ~ 15 pN nmÀ1 for forceclamp experiments and ... Corey, Nature 1 951 , 168, 55 0 55 1 [7] L Pauling, R B Corey, Proc Natl Acad Sci USA 1 953 , 39, 253 – 256 [8] G C Pimental, A L McClellan, The Hydrogen Bond, Freeman, San Francisco, 1960 [9] E N Baker,...
Ngày tải lên: 22/03/2014, 18:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo hóa học: " Research Article Fully Adaptive Clutter Suppression for Airborne Multichannel Phase Array Radar Using a Single A/D Converter" potx
... −130 50 (a) Dataset no rd50 153 Angle (deg) 50 100 (b) Dataset no rd5 057 5 Figure 7: Angle Doppler Map of the MCARM dataset no rd5 057 5 (range cell number 200 is chosen) −80 rd 150 150 rd 150 151 −100 ... data sets rd 150 15x (x = 2, 3, 4, 5) all have very similar curves The data set rd 150 5 75 has a very different clutter center (−108 Hz), whereas only two data sets (rd 150 150 and rd 150 151 ) have almost ... to achieve full adaptivity to the clutter, generally the radar system has to undergo a multiple -A/ D (hardware) upgrade where a number of sampled data streams are made available However, for practical...
Ngày tải lên: 21/06/2014, 08:20
báo cáo hóa học:" Research Article Ishikawa Iterative Process for a Pair of Single-valued and Multivalued Nonexpansive Mappings in Banach Spaces" doc
... Journal, vol 55 130 , no 4, pp 817–826, 20 05 B Panyanak, “Mann and Ishikawa iterative processes for multivalued mappings in Banach spaces,” Computers & Mathematics with Applications, vol 54 , no ... and H Wang, “Erratum to: “Mann and Ishikawa iterative processes for multivalued mappings in Banach spaces” Comput Math Appl 54 2007 872–877 ,” Computers & Mathematics with Applications, vol 55 , ... 70, no 4, pp 154 7– 155 6, 2009 N Shahzad and H Zegeye, “On Mann and Ishikawa iteration schemes for multi-valued maps in Banach spaces,” Nonlinear Analysis: Theory, Methods & Applications, vol 71,...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo sinh học: " Research Article A Double S-Shaped Bifurcation Curve for a Reaction-Diffusion Model with Nonlinear Boundary Conditions" doc
... bifurcation curves for the p-Laplacian perturbed Gelfand problem in one space variable,” Journal of Mathematical Analysis and Applications, vol 342, no 2, pp 11 75 1191, 2008 16 K J Brown, M M A Ibrahim, ... Korea Grant funded by the Korean Government NRF-2009- 353 -C00042 References R S Cantrell and C Cosner, Spatial Ecology via Reaction- Diffusion Equations, Wiley Series in Mathematical and Computational ... double S-shape appears but in this case the Ss overlap, yielding exactly positive solutions for a certain range of λ Acknowledgment Eun Kyoung Lee was supported by the National Research Foundation...
Ngày tải lên: 21/06/2014, 16:20
Báo cáo sinh học: " Research Article Quenching for a Reaction-Diffusion System with Coupled Inner Singular Absorption Terms Shouming Zhou and Chunlai Mu" pptx
... for a weakly coupled system of reaction- diffusion equations,” Archive for Rational Mechanics and Analysis, vol 129, no 1, pp 47–100, 19 95 J.-S Guo, S Sasayama, and C.-J Wang, “Blowup rate estimate ... rez-Llanos, and J D Rossi, “Incomplete quenching in a system of heat e equations coupled at the boundary,” Journal of Mathematical Analysis and Applications, vol 346, no 1, pp 1 45 154 , 2008 R Ji and ... estimate for a system of semilinear parabolic equations,” Communications on Pure and Applied Analysis, vol 8, no 2, pp 711–718, 2009 10 M Wang, “Blow-up rate estimates for semilinear parabolic...
Ngày tải lên: 21/06/2014, 16:20
Báo cáo hóa học: " Research Article Fixed Point Methods for the Generalized Stability of Functional Equations in a Single Variable" ppt
... bordering transformations,” Bulletin of the American Mathematical Society, vol 57 , pp 223–237, 1 951 Z Gajda, “On stability of additive mappings,” International Journal of Mathematics and Mathematical ... Mathematics Letters, vol 15, no 4, pp 4 35 438, 2002 37 R P Agarwal, B Xu, and W Zhang, “Stability of functional equations in single variable,” Journal of Mathematical Analysis and Applications, ... Reich, and A N Sharkovsky, Eds., vol 346 of Grazer Mathematische Berichte, pp 43 52 , Karl-Franzens-Univ Graz, Graz, Austria, 2004 21 L C˘ dariu and V Radu, A Hyers-Ulam-Rassias stability theorem for...
Ngày tải lên: 22/06/2014, 06:20
Báo cáo hóa học: " Research Article Pose-Encoded Spherical Harmonics for Face Recognition and Synthesis Using a Single Image" docx
... length f has to be assumed known, which is not always available for the uncontrollable test image We take the advantage that the facial features on the frontal view mean face are available, and show ... 3D face scans For a test image at a rotated pose and under an arbitrary illumination condition, we manually establish the image correspondence between the test image and a mean face image at the ... yes, and the reason lies on the fact that 2D harmonic basis images at different poses are related by close-form linear transformations This enables an analytic method for generating new basis images...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: "ON RANDOM COINCIDENCE AND FIXED POINTS FOR A PAIR OF MULTIVALUED AND SINGLE-VALUED MAPPINGS" pot
... Mathematical Society 95 (19 85) , no 1, 91–94 [19] N Shahzad and N Hussain, Deterministic and random coincidence point results for f nonexpansive maps, to appear in Journal of Mathematical Analysis and ... measurable A mapping s : Ω → X is called a measurable selector of a measurable multifunction T : Ω → 2X if s is measurable and s(ω) ∈ T(ω) for all ω ∈ Ω A measurable mapping ξ : Ω → X is called ... will mean Σ-measurability A mapping f : Ω × X → X is called a random operator if for any x ∈ X, f (·,x) is measurable A mapping T : Ω × X → CB(X) is called a multivalued random operator if for every...
Ngày tải lên: 22/06/2014, 22:20
A must for Sales people and anyone who meets and greets for a livingThe 5 most POWERFUL & EFFECTIVE ppt
... that remain with us for years is that certain “FEELING” that we had when dealing with someone, whether it was a fellow passenger on a bus or a salesperson in a store The bad feelings can easily ... others; we are a pack mentality and need other people that agree with our view points Talk in words that are appropriate for your audience - When you use words that are above your audience they ... you go WAK goes with you! That’s why it’s called “Walking Around Knowledge”; it’s always ready when you are! The more WAK you have the more comfortable you will be in any situation, especially if...
Ngày tải lên: 27/06/2014, 23:20
Báo cáo lâm nghiệp: "Do trees use reserve or newly assimilated carbon for their defense reactions? A 13 C labeling approach with young Scots pines inoculated with a bark-beetle-associated fungus (Ophiostoma brunneo ciliatum" pptx
... lead to a decreased resistance [7] Various abiotic factors, such as drought stress, air pollution and temperature stress, as well as attacks by biotic agents, may alter the resources available ... well-watered controls (Figs 2a and 2b) Daily water use was about 0. 45 L day−1 from an available soil water reserve of about L Predawn needle water potential (Ψwp ) fluctuated around −0.34 MPa throughout ... brunneo-ciliatum Means ± SE (n = 6) Stars indicate a significant drought effect; p < 0. 05 (aa = amino acids) zones was also noted As a consequence, C availability was reduced and the defense ability...
Ngày tải lên: 07/08/2014, 16:21
Báo cáo khoa học: " RadioImmunotherapy for adenoid cystic carcinoma: a single-institution series of combined treatment with cetuximab" docx
... pts Table patient characteristics patient characteristics median age [40 - 77] Epipharynx pts Fossa pterygopalatina pts Maxilla pt tuba auditiva tumour stage pts base of skull Analysis Treatment ... for locally advanced major salivary gland carcinoma Arch Otolaryngol Head Neck Surg 2009, 1 35: 687-692 Pederson AW, Haraf DJ, Blair EA, Stenson KM, Witt ME, Vokes EE, Salama JK: Chemoreirradiation ... Youssoufian H, Rowinsky EK, Ang KK: Radiotherapy plus cetuximab for locoregionally advanced head and neck cancer: 5- year survival data from a phase randomised trial, and relation between cetuximab-induced...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: "Intraoperative radiation therapy for advanced cervical metastasis: a single institution experience." pot
... in statistical analysis DW, SF, EK and RB contributed to discussion and data analysis TH participated in data analysis and manuscript writing All the authors read and approved the final manuscript ... head and neck surgeon and the radiation oncologist Despite advances in surgical and radiation techniques, survival rates in for patients with advanced cervical metastasis remains low From a radiobiology ... R: Management of advanced cervical metastasis using intraoperative radiotherapy Laryngoscope 19 95, 1 05: 5 75- 578 10 Ang KK, Harris J, Wheeler R, Weber R, Rosenthal DI, Nguyen-Tan PF, Westra WH,...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: "High-dose-rate brachytherapy for soft tissue sarcoma in children: a single institution experience" docx
... female/1 Male/2 Female/11 Female/9 Female/12 Male/2 Male/9 Female/12 Female/3 female/16 RMSE Synovial sarcoma ASPS Synovial sarcoma Synovial sarcoma ASPS RMSE ASPS ASPS fibrosarcoma Synovia sarcomal ... (IRS) staging used for both rhabdomyosarcomas and nonrhabdomyosarcomas ASPS= soft tissue sarcoma alveolar, RMSE= Rhabdomyosarcoma embryonary Page of (page number not for citation purposes) Radiation ... sarcoma (STS) These include external beam irradiation (EBRT), brachytherapy (BRT), and intraoperative radiation therapy Unfortunately, EBRT can cause growth retardation or adversely affect organ...
Ngày tải lên: 09/08/2014, 09:22
Green Energy and Technology - Energy for a Warming World Part 5 pot
... Kamchatka, and the Aleutian Islands Other examples are Iceland, which is the largest island on the Mid-Atlantic boundary of the North American and Eurasian plates, and the East African Rift Valley ... and geothermal activity associated with this fault ring is to be found in Alaska, California, Mexico, Central America, the Andes mountain range, New Zealand, Indonesia, Philippines, Japan, Kamchatka, ... ecological importance Land area available for massive solar farms is not ‘unlimited’ and reasoned deliberation suggests that an upper limit of 4 .5 TW of electrical power is available from solar sources...
Ngày tải lên: 09/08/2014, 11:20
Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt
... Kubo T, Takatori Y, Saito S, Fujioka M, Sudo A, Uchida A, Yamamoto S, Ozaki K, Takigawa M, Tanaka T, Nakamura Y, Jiang Q, Ikegawa S: A functional polymorphism in the 5' UTR of GDF5 is associated with ... Yoshida A, Tominaga S, Nagano J, Shimizu A, Wakana S, Gondo Y, Noda T, Shiroishi T, Ikegawa S: A novel dominant-negative mutation in Gdf5 generated by ENU mutagenesis impairs joint formation and causes ... JR, Savarirayan R, White SM, Graham JM Jr, Gale RP, Svarch E, Newman WG, Kleckers AR, Francomano CA, Govindaiah V, Singh L, Morrison S, Thomas JT, Warman ML: The mutational spectrum of brachydactyly...
Ngày tải lên: 09/08/2014, 13:22
Rising Above the Gathering Storm Energizing and Employing America for a Brighter Economic Future phần 5 pot
... to the National Academies, she was a mathematician for the Air Force, an air-pollution engineer for the state of Texas, and an air-issues manager for the Chemical Manufacturers Association She ... for the Advancement of Science (AAAS) and chairman of the AAAS board of directors, a member of the National Academy of Engineering, and a fellow of the American Academy of Arts and Sciences and ... is a member of the American Academy of Arts and Sciences, the National Academy of Sciences, and the American Philosophical Society He is also a fellow of the American Association for the Advancement...
Ngày tải lên: 09/08/2014, 23:20
Feedback.Control.for.a.Path.Following.Robotic.Car Part 5 ppt
... that used by the FLASH vehicle The car’s methods of measurement and calculation are the same in the simulation as in the hardware However, in the simulation, an ideal path is created for the car ... initialization involves creating the car and path for animation and placing the car on the path Next, the car’s position on the path is determined and the values needed by the controller are calculated ... centerline came in at an angle or was located in one small part of the image away from the center Poorer results were obtained when calculations were made using pixels located away from the center...
Ngày tải lên: 10/08/2014, 02:20