5 8 factors that affect ethical and unethical behavior
An adult accelerated degree program, student and instructor perspectives and factors that affect retention
Ngày tải lên :
30/09/2015, 13:42
... 48 Importance of Advising 50 Summary 52 Chapter Three – Methods 53 Research Questions and Hypothesis 53 Programs Examined for Study 54 ... person’s behavior A person’s behavior is influenced by many factors, such as culture, upbringing, education, and motivation Cognitive learning involves understanding how these factors influence behavior ... societies and economies, emphasizes the need for people who are adaptable and responsive (Candy, 20 05) Adults will learn best in new environments that provide support and safety for testing new behaviors...
- 182
- 697
- 0
Birthweight percentiles by gestational age and maternal factors that affect birthweight in singapore
Ngày tải lên :
02/10/2015, 12:55
... 1 35 681 82 89 8 21 – 25 years old 656 1,673 50 7 2 ,83 6 26 – 30 years old 2, 654 2,164 1,431 6,249 31 – 35 years old 3,396 1,6 85 1,142 6,223 36 – 40 years old 1,663 9 25 376 2,964 214 2 08 42 464 8, 7 18 ... (37.6) 2,0 35 (27.7) 1 ,59 7 (44.6) 6,906 ( 35. 2) 1,241 (14.2) 1 , 58 8 (21.6) 4 15 (11.6) 3,244 (16 .5) 256 (2.9) 923 (12.6) 100 (2 .8) 1,279 (6 .5) or more 34 (0.4) 50 5 (6.9) 31 (0.9) 57 0 (2.9) 8, 7 18 (100) ... Malay (%) Indian (%) Total Hypertensive diseases 3 18 (3.7) 330 (4 .5) 87 (2.4) 7 35 Diabetes 704 (8. 1) 4 05 (5. 5) 350 (9 .8) 1 459 Anemia 40 (0 .5) 155 (2.1) 36 (1.0) 231 Table 9: Number of women who...
- 106
- 226
- 0
Birthweight percentiles by gestational age and maternal factors that affect birthweight in singapore
Ngày tải lên :
13/10/2015, 15:54
... 1 35 681 82 89 8 21 – 25 years old 656 1,673 50 7 2 ,83 6 26 – 30 years old 2, 654 2,164 1,431 6,249 31 – 35 years old 3,396 1,6 85 1,142 6,223 36 – 40 years old 1,663 9 25 376 2,964 214 2 08 42 464 8, 7 18 ... (37.6) 2,0 35 (27.7) 1 ,59 7 (44.6) 6,906 ( 35. 2) 1,241 (14.2) 1 , 58 8 (21.6) 4 15 (11.6) 3,244 (16 .5) 256 (2.9) 923 (12.6) 100 (2 .8) 1,279 (6 .5) or more 34 (0.4) 50 5 (6.9) 31 (0.9) 57 0 (2.9) 8, 7 18 (100) ... Malay (%) Indian (%) Total Hypertensive diseases 3 18 (3.7) 330 (4 .5) 87 (2.4) 7 35 Diabetes 704 (8. 1) 4 05 (5. 5) 350 (9 .8) 1 459 Anemia 40 (0 .5) 155 (2.1) 36 (1.0) 231 Table 9: Number of women who...
- 106
- 336
- 0
The factors that affect organizational citizenship behaviors at the viet nam international commercial joint stock bank
Ngày tải lên :
10/12/2015, 00:10
... (H4) 51 5. 1 Summary of the Results: 53 5. 2 Discussion and Recommendation 54 5. 3 Limitation and Future Research 55 REFERENCES 56 APPENDIX - ... (Bateman and Organ, 1 983 ; Schnake, 1991) The theoretical and empirical evidence confirms that job satisfaction predicts OCB (Niehoff and Moorman, 1993; Organ, 1 988 ; Organ and Ryan, 19 95; Schnake, ... Description Variable Frequency Percent (%) Male 1 25 42.09% Female 172 57 .96% < 25 49 16 .50 % 25 – 30 117 39.39% 30 – 40 95 31.99% >40 36 12.12% Marital Single 85 28. 62% Status Married without children 96...
- 74
- 445
- 0
A STUDY ON FACTORS THAT AFFECT ON THE FIXED BED GASIFICATION PROCESS NGHIÊN cứu một số yếu tố ẢNH HƯỞNG đến QUÁ TRÌNH KHÍ hóa TRẤU TẦNG cố ĐỊNH
Ngày tải lên :
14/01/2016, 15:28
... [%] 1. 05 3,397. 68 0.00 0,00 2 .55 3,397. 68 441.70 13.00 51 5 Kỷ yếu hội nghị khoa học công nghệ toàn quốc khí - Lần thứ IV 4. 05 3,397. 68 50 9. 65 15. 00 5. 57 3,397. 68 421.31 12.40 7.03 3,397. 68 356 .76 ... [%] [Kcal] [Kcal] Capacity [%] 10 .50 3,397. 68 4 85 . 87 14.30 17.30 3,397. 68 4 28. 11 12.60 25. 10 3,397. 68 2 95. 60 8. 70 31.60 3,397. 68 81 .54 2.40 40 .50 3,397. 68 0.00 0.00 Velocity - Efficiency Chart ... Chart 16.00 14.00 Efficiency % 12.00 10.00 8. 00 6.00 4.00 2.00 0.00 1. 05 2 .55 4. 05 5 .57 7.03 8 .52 Velocity cm/s Figure Velocity - Efficiency Chart 51 6 10.06 Kỷ yếu hội nghị khoa học công nghệ...
- 6
- 298
- 0
The Six Driving Forces That Affect Your Business Plan _ And How to Focus on the Best One for Your Company’s Needs
Ngày tải lên :
24/10/2013, 09:20
... the United States, and Randall was considered the dean That was because of quality and style When The Six Driving Forces That Affect Your Business Plan 163 the Vietnam War and movies made big, ... “You must have that phone permanently attached to your ear.” He just grinned, reached back, pulled out his wallet, and The Six Driving Forces That Affect Your Business Plan 155 said, “No, not ... Program that guarantees you a room after P.M Walk in, hand the desk your card, and they hand you a key It’s that simple If there is a delay, you get the room free for the night plus 5, 000 flyer...
- 28
- 825
- 0
Tài liệu Báo cáo khoa học: "Which words are hard to recognize? Prosodic, lexical, and disfluency factors that increase ASR error rates" ppt
Ngày tải lên :
20/02/2014, 09:20
... Disc 19.7 18. 0 19.6 43 .8 50 .5 5 .8 18. 8 17 .8 19.0 43.9 49.6 6.6 1st 21.2 6.2 20.3 6.4 Sex M 20.6 52 .5 20.0 52 .2 F 17.0 47 .5 16.4 47 .8 All 18. 8 100 18. 3 100 Table 2: IWER by feature and percentage ... 1.7 1.7 17.6 17.2 1.9 1 .8 Fragment Bef Aft 33 .8 21.6 1.6 1 .5 32.0 21 .5 1.6 1 .5 Repetition Bef Aft NonF Fin 16.7 13 .8 26.0 11.6 0.7 0.9 1.2 1.1 15. 8 14.2 25. 1 11.6 0 .8 0 .8 1.4 1.1 Syntactic Class ... Edinburgh-Stanford LINK and ONR MURI award N00014 051 0 388 We thank Andreas Stolcke for providing the ASR output, language model, and forced alignments used here, and Raghunandan Kumaran and Katrin Kirchhoff...
- 9
- 441
- 0
Báo cáo khoa học: Assessment of telomere length and factors that contribute to its stability potx
Ngày tải lên :
17/03/2014, 09:20
... 16 14 15 [57 , 58 ] [55 ] [55 ] [55 ] [55 ] T-OLA HUVEC Fibroblasts and lymphocytes HeLa (cervical cancer cell line) and U937 cells Fibroblasts, lymphocytes HeLa, and U937 cells Fibroblasts and lymphocytes ... > 80 [57 , 58 ] Electron microscopy BJ foreskin fibroblasts HUVEC BJ foreskin fibroblasts IMR90 lung fibroblasts MEC (mammary epithelial cells) 200 ± 75 2 25 650 50 – 350 100–300 1 75 350 ND 14 16 14 15 ... Primer extension/nick translation (PENT) [56 58 ], electron microscopy of purified telomeres [57 , 58 ], and telomeric-oligonuceotide ligation assay (T-OLA) [56 ] are all suitable methods for the determination...
- 15
- 387
- 0
Math Puzzles and Brainteasers, Grades 3-5: Over 300 Puzzles that Teach Math and Problem-Solving Skills pptx
Ngày tải lên :
25/03/2014, 20:22
... e and make it a T ke your tim fun Copyright © 2009 by John Wiley & Sons, Inc 444,444 55 5 ,55 5 666,666 46 What is the next number in the sequence below? 142, 85 7 2 85 , 714 4 28 ,57 1 57 1,4 28 ... sequence below? 142, 85 7 2 85 , 714 4 28 ,57 1 57 1,4 28 14,2 85 Copyright © 2009 by John Wiley & Sons, Inc ? ? ? ,? ? ? a 7 85 , 241 b 58 7,421 c 8 75, 421 d 85 7 ,142 47 The average of four positive integers ... Copyright © 2009 by John Wiley & Sons, Inc ? 1 5 4 8 7 11 10 14 13 17 18 What is the missing number? 5 25 1 25 3,1 25 15, 6 25 19 One of the numbers below does not belong...
- 254
- 730
- 8
Báo cáo sinh học: "Radio wave propagation in curved rectangular tunnels at 5.8 GHz for metro applications, simulations and measurements" pot
Ngày tải lên :
18/06/2014, 22:20
... simulations and fitted distribution and values of fitted statistic distributions in a curved rectangular tunnel— 5. 8 GHz Global Rayleigh Zone Zone 20 KS 0. 25 0. 28 0.24 σ 3 .50 3. 48 3 .50 KS 0. 25 0. 28 0.24 ... 3 .50 3. 48 3 .50 KS 0. 25 0. 28 0.24 K 0 σ 3 .50 3. 48 3 .50 KS 0. 08 0.09 0. 08 m 0.40 0. 38 0.40 ω 24.49 24.22 24 .51 KS 0.03 0.04 0.03 k 3. 65 3 .53 3.66 l 1.09 1. 05 1.09 Rice Nakagami Weibull Figure Figure ... concordance between the simulations and the measurements is observed A mean and a standard deviation of the error between measurements and simulations of 2. 15 and 2 .55 dB are, respectively, obtained...
- 32
- 458
- 0
báo cáo hóa học:" Radio wave propagation in curved rectangular tunnels at 5.8 GHz for metro applications, simulations and " potx
Ngày tải lên :
20/06/2014, 04:20
... simulations and fitted distribution and values of fitted statistic distributions in a curved rectangular tunnel— 5. 8 GHz Global Rayleigh Zone Zone 20 KS 0. 25 0. 28 0.24 σ 3 .50 3. 48 3 .50 KS 0. 25 0. 28 0.24 ... 3 .50 3. 48 3 .50 KS 0. 25 0. 28 0.24 K 0 σ 3 .50 3. 48 3 .50 KS 0. 08 0.09 0. 08 m 0.40 0. 38 0.40 ω 24.49 24.22 24 .51 KS 0.03 0.04 0.03 k 3. 65 3 .53 3.66 l 1.09 1. 05 1.09 Rice Nakagami Weibull Figure Figure ... concordance between the simulations and the measurements is observed A mean and a standard deviation of the error between measurements and simulations of 2. 15 and 2 .55 dB are, respectively, obtained...
- 32
- 603
- 0
Sandiford et al. Journal of Orthopaedic Surgery and Research 2010, 5:8 pot
Ngày tải lên :
20/06/2014, 07:20
... Harris, Oxford and WOMAC hip scores were 54 .1 (7 - 97), 37.0 (13 - 57 ) and 45. 9 (1 - 94) respectively Mean post operative scores were 96 .8 (59 - 100), 15. 0 (12 - 35) and 6.1 (0 - 56 ) respectively ... and WOMAC scores were 46.4 (7 - 87 ), 41.1 (range 16 - 75) and 50 .9 (3 - 96) respectively Average post operative scores were 95. 8 ( 65 - 100), 14 .8 (12 - 33) and 5. 0 (0 39) respectively The Harris ... 75 93 Females 59 UCLA Score (pre-op) UCLA Score (post-op) Patient Demographics Mean age (range) Mean BMI3 100 90 Pr e-o p 44 80 Po st-o p 70 60 53 .9 (24 .8 - 64.6) 26.0 (17.2 - 37.6) 55 .3 ( 28. 4-64.6)...
- 6
- 427
- 0
Báo cáo toán học: " Radio wave propagation in curved rectangular tunnels at 5.8 GHz for metro applications, simulations and measurements" docx
Ngày tải lên :
20/06/2014, 21:20
... rectangular tunnel 5. 8 GHZ Global Zone Zone KS 0. 25 0. 28 0.24 s 3 .50 3. 48 3 .50 KS K 0. 25 0. 28 0.24 s 3 .50 3. 48 3 .50 KS 0. 08 0.09 0. 08 m 0.40 0. 38 0.40 ω 24.49 24.22 24 .51 KS k 0.03 3. 65 0.04 3 .53 0.03 3.66 ... A first global analysis is performed on 350 m and a second on the two zones presented in Section 5. 3: Zone (0- 25 m) and Zone ( 25- 350 m) Figures 9, 10, and 11 present the CDF of the simulated results ... and prediction (19 95) doi:10.1 186 /1 687 -1499-2011-202 Cite this article as: Masson et al.: Radio wave propagation in curved rectangular tunnels at 5. 8 GHz for metro applications, simulations and...
- 8
- 470
- 0
5 bước để thật xinh đẹp trong ngày 8/3 pot
Ngày tải lên :
01/07/2014, 10:44
... gam màu sáng, buổi tối, dùng màu mắt đậm hơn, tạo độ sắc nét cho đôi mắt Có thể gắn mi giả Bước 5: Cuối cùng, với môi má hồng, tùy theo trang phục mà chọn màu thích hợp Nếu vào ban đêm, làm đậm...
- 3
- 168
- 0
5 bước để thật xinh đẹp trong ngày 8/3 potx
Ngày tải lên :
29/07/2014, 08:20
... gam màu sáng, buổi tối, dùng màu mắt đậm hơn, tạo độ sắc nét cho đôi mắt Có thể gắn mi giả Bước 5: Cuối cùng, với môi má hồng, tùy theo trang phục mà chọn màu thích hợp Nếu vào ban đêm, làm đậm...
- 4
- 170
- 0
Báo cáo toán học: "Mutually Disjoint Steiner Systems S(5, 8, 24) and 5-(24, 12, 48) Designs" pptx
Ngày tải lên :
08/08/2014, 01:20
... Steiner systems S (5, 8, 24) and 5- (24, 12, 48) designs Proposition There are at least 50 mutually disjoint Steiner systems S (5, 8, 24) There are at least 35 mutually disjoint 5- (24, 12, 48) designs ... 21}, {8, 9, 11, 12, 14, 15, 16, 17, 18, 20, 23, 24}), H (7) = Sym({13, 21}) × Sym( {8, 9, 11, 12, 14, 15, 16, 17, 18, 20, 23, 24}) × Sym({10, 19, 22}) We note that |U6 | = 969 and |U7 | = 455 Description ... 15, 23, 8, 13, 16, 12, 14, 9, 10, 19)( 18, 21) 5 = (6, 19, 11, 7, 22, 23, 10) (8, 16, 21, 14, 18, 13, 17, 9, 12, 15) α6 = (7, 8, 22, 23, 19, 15, 21, 17, 14)(9, 10, 24, 11, 12) α7 = (7, 17, 15, ...
- 6
- 233
- 0
Báo cáo toán học: "Mutually Disjoint Steiner Systems S(5, 8, 24) and 5-(24, 12, 48) Designs" docx
Ngày tải lên :
08/08/2014, 11:20
... Steiner systems S (5, 8, 24) and 5- (24, 12, 48) designs Proposition There are at least 50 mutually disjoint Steiner systems S (5, 8, 24) There are at least 35 mutually disjoint 5- (24, 12, 48) designs ... 21}, {8, 9, 11, 12, 14, 15, 16, 17, 18, 20, 23, 24}), H (7) = Sym({13, 21}) × Sym( {8, 9, 11, 12, 14, 15, 16, 17, 18, 20, 23, 24}) × Sym({10, 19, 22}) We note that |U6 | = 969 and |U7 | = 455 Description ... 15, 23, 8, 13, 16, 12, 14, 9, 10, 19)( 18, 21) 5 = (6, 19, 11, 7, 22, 23, 10) (8, 16, 21, 14, 18, 13, 17, 9, 12, 15) α6 = (7, 8, 22, 23, 19, 15, 21, 17, 14)(9, 10, 24, 11, 12) α7 = (7, 17, 15, ...
- 6
- 176
- 0
Báo cáo y học: " Factors that may mediate the relationship between physical activity and the risk for developing knee osteoarthritis" pot
Ngày tải lên :
09/08/2014, 10:22
... citation purposes) 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 Schnitzer TJ, Kirwan-Mellis G, Andriacchi TP: Knee adduction moment, serum hyaluronan level, and disease severity in medial ... miles/week; OR 0 .84 , 95% CI 0.37 to 1.92); working up a sweat (≥3 times/week; OR 1.04, 95% CI 0 .55 to 1.96); and activity level compared with peers (more active; OR 0.63, 95% CI 0. 35 to 1.16) Measure(s) ... periods [55 ] and only moderate reproducibility [57 ] An alternative, accelerometry, provides an objective and reliable measure of the frequency, duration and intensity of physical activity [ 58 ] Although...
- 10
- 310
- 0
Báo cáo y học: " HIV-1 infection induces changes in expression of cellular splicing factors that regulate alternative viral splicing and virus production in macrophages" doc
Ngày tải lên :
13/08/2014, 06:20
... using primers Odp423 (5' CGGCGACTGAATTGGGTG;7 35- 743 +57 7 85 7 86 [SD1-SA3])/Odp003 (5' GTCTCTCTCTCCACCTTCTTCTTC; 84 47 -84 24) and Odp424 (5' CGGCGACTGGAAGAAGCG; 7 35- 743 +59 77 -59 85 [SD1-SA5])/Odp003 respectively ... Retrovirology 20 08, 5: 18 150 hnRNP A2 Relative % mRNA R ela tive % m R N A 150 http://www.retrovirology.com/content /5/ 1/ 18 100 50 100 50 14 21 28 hnRNP B1 35 Days Post-Infection 21 28 35 Days Post-Infection ... amounts of cDNA from infected MDM and PBL using primers Odp0 45 ( 487 –4 98 of HXB2 genome, exon and Odp032 ( 85 0 7 84 87, exon 7) [16], then relative expression of tat, rev and nef mRNAs determined by electrophoresis...
- 12
- 285
- 0
