... Treasury bill rate Sources: DataStream, National data; BIS calculations Table Floating rate issuance of AAA-rated securities by sector As a % of total AAA issuance Sovereign ABS Mortgage institutions ... bonds Table Standard deviations of interest rate changes Table Floating rate issuance of AAA-rated securities by sector Table AAA-rated issuance by mortgage institutions, public sector banks Table ... by 2001, and to a peak of $2.8 trillion in 2006 (Graph 7) During these years, non-financial corporate AAA issuance tended to decline as the population of AAA corporations shrank Issuance in these...
Ngày tải lên: 17/02/2014, 03:20
... I.Warm up II.Presentation 1,New words Time (n) giê (Ten) o’clock :10 giê Half past (ten) / ten thirty :10:30 Be late for: muén We are late for school :Chóng ta ®i häc muén 2.Grammar What ... ten fifteen half past ten III.Practice * Picture Drill 2.10 6.00 1.30 10.00 7.30 8.25 5.15 9 .45 IV.Further practice *Noughts and Crosses 6.10 X 6.30 7.00 X 11.00 3.15 X X 6 .45 X 11.30 4. 20 X X X ... Crosses 6.10 X 6.30 7.00 X 11.00 3.15 X X 6 .45 X 11.30 4. 20 X X X 5.30 X V.Homework _ Learn vocab _ Do exercises C4-C7 ...
Ngày tải lên: 19/07/2014, 08:00
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 42 9-bp product from genomic DNA (Fig 1A) The ... 1 145 -9 Tamura N, Ogawa Y, Chusho H, et al Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 42 39 -44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic ... like to thank Dr Y Watanabe and Dr Y Izumi for collecting the samples, and Ms H Tobe, M Nakamura, and K Sugama for their technical assistance This work was supported financially by a grant from...
Ngày tải lên: 26/10/2012, 10:04
Critical Chain: A New Project Management Paradigm or Old Wine in New Bottles? pdf
... their latest start dates During the execution phase, an attempt is made to maintain the planned start dates for these gating activities For all other activities, the planned start dates are ignored ... activity may set off a cascading effect that delays the start of a critical chain activity (see Herroelen and Leus, 2001) Behavioral Issues The planning tactics of CC assume that behaviors can be ... project management Probably the most dramatic difference between the two approaches is that CP monitors and reports activity start and finish times and performance against calendar fixed due dates...
Ngày tải lên: 16/03/2014, 01:20
FRANKLIN TEMPLETON INVESTMENT FUNDS: SOCIÉTÉ D''''INVESTISSEMENT À CAPITAL VARIABLE 2012 doc
... Laganside Corporation, Chairman of Calor Teoranta (Ireland) and a Director of Belfast International Airport Ltd He has also previously been a Director of The Industrial Development Board for Northern ... Director, Mr Frank oversaw the South Asia and Latin America operations and chaired the Banks Finance Committee At the IFC, Mr Frank served as CFO leading the Corporation to become an AAA borrower and ... swaps Class A( dis) and Class A( acc) shares’ maintenance charges (note 13) Class AX(acc) shares’ maintenance charges (note 13) Class B(dis) and Class B(acc) shares’ maintenance and service charges...
Ngày tải lên: 23/03/2014, 08:21
FRANKLIN TEMPLETON INVESTMENT FUNDS: SOCIÉTÉ D''''INVESTISSEMENT À CAPITAL VARIABLE 2011 potx
... Forward foreign exchange contracts Forward exchange contracts are valued at the forward rate applicable at the “Statement of Net Assets” date for the remaining period, until maturity Gains or ... which are listed on a stock exchange or traded on any other organised market are valued at the last available price on such exchange or market which is normally the principal market for each security, ... Franklin Asian Flex Cap Fund – USD Franklin Asian Flex Cap – A (Acc) 2.00% 507,763. 549 11.58 14. 03 Franklin Asian Flex Cap – A (Acc) – SGD 2.00% 695 .41 4 6.69 7.68 Franklin Asian Flex Cap – A...
Ngày tải lên: 23/03/2014, 08:21
Social capital and Health status: a protective impact among elderly or inactive but not among active ? doc
... self-assessed health status and to have a regular social participation on whole population Finding indicates that after instrumentation, social capital (that is to say having a regular social participation) ... homemakers aged more than 55 years old take advantage of social participation because they have more time and fewer familial constraints and thus not have as much pressure as the “active” population ... disparities Social capital is actually considered as a potential explanatory factor of an individual’s health status since social interaction, trust and reciprocity facilitate people to access...
Ngày tải lên: 28/03/2014, 20:20
theory of functions of a real variable - s. sternberg
... equation (2 .4) it is called a norm A vector space endowed with a norm is called a normed space The pre-Hilbert spaces can be characterized among all normed spaces by the parallelogram law as ... contains many more details and beautiful examples and pictures Chapter V is a standard treatment of the Lebesgue integral Chapters VI, and VIII deal with abstract measure theory and integration ... Separability A metric space X is called separable if it has a countable subset {xj } of points which are dense For example R is separable because the rationals are countable and dense Similarly,...
Ngày tải lên: 31/03/2014, 15:23
the executor's guide, settling a loved one's estate or trust 3rd (2008)
... information on bulk purchases or corporate premium sales, please contact the Special Sales epartment For academic sales or textbook D adoptions, ask for Academic Sales Call 800-955 -47 75 or ... directions—in as much or as little detail as is comfortable—in a separate, easily accessible document For information on options involving organ or body donation, cremation or burial, and a host of related ... Probate an Estate in California I’ve had the pleasure of working with Julia since I came to Nolo many years ago, and her wonderful book was an invaluable help Twila Slesnick, coauthor of another...
Ngày tải lên: 18/04/2014, 14:12
the executor's guide, settling a loved one's estate or trust 3rd (2008)
... information on bulk purchases or corporate premium sales, please contact the Special Sales epartment For academic sales or textbook D adoptions, ask for Academic Sales Call 800-955 -47 75 or ... directions—in as much or as little detail as is comfortable—in a separate, easily accessible document For information on options involving organ or body donation, cremation or burial, and a host of related ... Probate an Estate in California I’ve had the pleasure of working with Julia since I came to Nolo many years ago, and her wonderful book was an invaluable help Twila Slesnick, coauthor of another...
Ngày tải lên: 18/04/2014, 14:14
frommer's australia from 50 a day, 13th edition
... Queensland, Victoria, South Australia, Western Australia, and Tasmania—and two internal “territories”—the Australian Capital Territory (ACT) and the Northern Territory The national capital is Canberra, ... not all day, on Anzac Day, a World War I commemorative day on April 25 Among the major public holidays are: New Year’s Day (Jan 1); Australia Day (Jan 26); Labour Day (2nd Mon in Mar, WA and ... a few you can’t Eat Vietnamese, Cambodian, Singaporean, Malaysian, Indonesian, and more, and then shop the 200 arts-and-crafts stalls, get a Chinese head massage, or have your tarot cards read...
Ngày tải lên: 24/04/2014, 16:57
báo cáo hóa học: " Self-reported physical and mental health status and quality of life in adolescents: a latent variable mediation model" doc
... 1Self-reported physical and mental health status were modeled as two ordinal variables with a latent factor that accounts for their correlation (not shown here) *p < 05 obtain information about tobacco ... far the most important variable explaining QOL Beckie and Hayduk [ 24] , using structural equation modeling, similarly demonstrated that indicators of health status could be viewed as explanatory ... function and using a mean and variance adjusted weighted-least squares estimation method (WLSMV) suitable for ordinal data [60] Model fit was evaluated with several global fit indices, and by comparing...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Research Article Fixed Point Methods for the Generalized Stability of Functional Equations in a Single Variable" ppt
... vol 346 of Grazer Mathematische Berichte, pp 43 –52, Karl-Franzens-Univ Graz, Graz, Austria, 20 04 21 L C˘ dariu and V Radu, A Hyers-Ulam-Rassias stability theorem for a quartic functional equation,” ... approximately additive mapa ¸ pings,” Journal of Mathematical Analysis and Applications, vol 1 84, no 3, pp 43 1 43 6, 19 94 10 J M Rassias, “On the stability of the Euler-Lagrange functional equation,” ... the American Mathematical Society, vol 57, pp 223–237, 1951 Z Gajda, “On stability of additive mappings,” International Journal of Mathematics and Mathematical Sciences, vol 14, no 3, pp 43 1 43 4,...
Ngày tải lên: 22/06/2014, 06:20
The Integration of Functions of a Single Variable, by G. H. Hardy pptx
... where m and n are positive integers, the a s and b’s are constants, and the numerator and denominator have no common factor We shall adopt this expression as the standard form of a rational function ... (b) a2 t(t2 + a2 ) , t4 + a4 y= a2 t(t2 − a2 ) t + a4 The curve 2ay − 3a2 y = x4 − 2a2 x2 has the double points (0, 0), (a, a) , ( a, a) Using the auxiliary conic x2 − ay = tx(y − a) , we find a a ... integral of an algebraical function we shall consider one most important case in which the integral can be at once reduced to that of a rational function, and is therefore always an elementary...
Ngày tải lên: 28/06/2014, 19:20
Báo cáo khoa hoc:" The "Statinth" wonder of the world: a panacea for all illnesses or a bubble about to burst" pps
... atorvastatin in type diabetes in the Collaborative Atorvastatin Diabetes Study (CARDS): multicenter randomised placebo-controlled trial Lancet 20 04, 3 64: 685-696 Inoue E, Takashashi F, Katayama ... Trial- Lipid Lowering Arm (ASCOT-LLA): a multicenter randomized control trial Lancet 2003, 361:1 149 -1158 Cannon SP, Braunwald E, Mc Cabe H, et al.: Pravastatin or Atorvastatin Evaluation and ... who had no preexisting CAD Collaborative Atorvastatin Diabetes Study (CARDS) was carried out to evaluate the efficacy and safety of low-dose atorvastatin treatment in primary prevention of CAD...
Ngày tải lên: 11/08/2014, 08:20
Báo cáo khoa học: "Herpes simplex virus type 2 tegument protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/or release of virions" ppt
... 1:200; BD) antibodies AlexaFluor 48 8- or AlexaFluor 647 - conjugated goat anti-rabbit, AlexaFluor 546 - or AlexaFluor 647 - conjugated goat anti-mouse, and AlexaFluor 546 -conjugated goat antisheep ... 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 Koshizuka T, Goshima F, Takakuwa H, Nozawa N, Daikoku T, Koiwai O, Nishiyama Y: Identification and characterization of the UL56 gene ... manuscript YN performed project planning, participated in the data analysis and helped to draft the manuscript All authors read and approved the final manuscript Weissman AM: Themes and variations on...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "Is Phytalgic® a goldmine for osteoarthritis patients or is there something fishy about this nutraceutical? A summary of findings and risk-of-bias assessment" pot
... double-blinding supports a low risk of performance bias as the authors state that the manufacturer provided both the Phytalgic® and placebo capsules and that it claimed that they were identical and indistinguishable ... on OA in smaller studies, later and presumably more strictly led RCTs with less bias have claimed results that are more moderate, with an anticipated overall ES on pain of –0.33 standard deviation ... or nutraceuticals RC is statistical editor for the Cochrane Musculoskeletal Group and a member of the GRADE Working Group RC and HB have received research or institutional support, educational...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: "The counterintuitive effect of multiple injuries in severity scoring: a simple variable improves the predictive ability of NISS" ppt
... Chieregato Arturo Azienda Usl di Cesena, Corsi Amedeo - Azienda Usl di Rimini, Fabbri Andrea - Azienda Usl di Forlì, Ferrari Annamaria - Azienda Ospedaliera Santa Maria Nuova di Reggio Emilia, Ferri ... Luigi - Azienda Usl di Cesena, Trabucco Laura - Azienda Ospedaliera Santa Maria Nuova di Reggio Emilia, Volpi Annalisa - Azienda Ospedaliero-Universitaria di Parma Some data from this manuscript ... Enrico - Azienda Ospedaliero-Universitaria S Anna di Ferrara, Gambale Giorgio - Azienda Usl di Forlì, Gamberini Alfio Azienda Usl di Ravenna, Giugni Aimone - Azienda Usl di Bologna, Gordini Giovanni...
Ngày tải lên: 13/08/2014, 23:20
HÌNH HỌC KHÔNG GIAN ( 50 A SP TOÁN- ĐH VINH)
... tài liệu có sẵn theo từng phân nhóm Bước 6: Lúc này, ta a có toàn cảnh cu a vấn đề Ta bắt đầu tổng kết, a nh giá mặt mạnh, mặt yếu cu a các giải pháp, đ a quan hệ hỗ tương các ... S.ABCD C O’ A D Bài toán tổng quát 2: Tìm tâm đường tròn ngoại tiếp hình chóp có đáy tứ giác nội tiếp đường tròn Giải d S O I A4 A1 O’ A2 A3 Cách tìm tâm mặt cầu ngoại tiếp cu a bài này ... OA=OB=OC (1) • Mặt khác ta lại có AIO= SIO (c.g.c) OA=OS (2) • I O Từ (1) (2): OA=OB=OC=OS Hay O tâm mặt cầu ngoại tiếp chóp tam giác SABC A C O’ N B M Bài toán 2: Cho tứ diện S.ABC...
Ngày tải lên: 04/06/2015, 22:00
NGUYÊN HÀM ( 50 A SP TOÁN- ĐH VINH)
... MSV:095100 540 9 GVHD:Th.s Nguyễn Chiến Thắng Khái quát h a Khái quát h a toán từ nội dung toán ta suy toán lớn hơn, rộng để hiểu rõ Khái quát h a: là chuyển từ đối tượng sang tập hợp lớn ch a tập ... tập hợp ban đầu cách nêu bật số đặc điểm chung phần tử tập hợp xuất phát Như vậy, ta thấy trừu tượng h a điều kiện cần khái quát h a Ví dụ 1: Tính tích phân: ∏/2 l= sinxdx ∫ Giải Ta có π /2 ... /2 l1 = ∫ sinxdx = − cos x |π / = 0 π /2 l2 = ∫ sin xdx = π /2 ∫ − cos x π dx = Từ Ví dụ ta khái quát sau: Vi dụ : cho tích phân ln = π /2 sin xdx ∫ n ...
Ngày tải lên: 04/06/2015, 22:00