3phase heterogeneity dissolved organic carbon interstitial water and particulate matter
Organic Chemicals : An Environmental Perspective - Chapter 3 doc
Ngày tải lên :
11/08/2014, 04:20
... the phase heterogeneity of the water mass in many natural systems and to the role of both particulate and dissolved matter in the distribution and dissemination of xenobiotics in lakes and rivers ... phase is heterogeneous and often contains particulate matter including inorganic material, and both soluble and insoluble organic matter originating from aquatic biota and terrestrial plants ... important issues: The sorption to particulate matter in the water column, and the dynamics and resuspension of surficial sediments; The role of dissolved organic matter in the water column, accompanied...
- 99
- 354
- 0
The Role of Small and Large Businesses in Economic Development doc
Ngày tải lên :
06/03/2014, 19:20
... (Morisette), Germany (Schmidt and Zimmermann), Austria (Winter-Ember), the United Kingdom (Belfield and Wei), and Switzerland (Winter-Ember and Zweimüller), among others Kraybill and others show that ... Audretsch, and M.B Feldman 1994 “R&D Spillovers and Recipient Firm Size,” Review of Economics and Statistics, vol 76, no 2, pp 336-39 Anderson, P.M., and B.D Meyer 1994 “The Extent and Consequences ... levels of taxation and regulation; and, through good government and quality amenities, have created the kinds of communities where highly educated and skilled people want to live and work ECONOMIC...
- 25
- 660
- 0
The Role of Gestures and Facial Cues in Second Language Listening Comprehension pptx
Ngày tải lên :
10/03/2014, 05:20
... AV-face and AV-gesture-face) and t-test statistics comparing higher and lower proficiency group scores Table Sueyoshi and Hardison 687 comprehension of a lecture Participants in the AV-gestureface and ... condition, and there were two audiovisual (AV) conditions: AV-gesture-face, which showed both the lecturer’s gestures and facial cues, and AVface, which showed the lecturer’s head and upper shoulders ... preference for visual cues in communication and their choice of activities for Sueyoshi and Hardison the development vocabulary? of listening and speaking 669 skills and Does proficiency level affect the...
- 39
- 919
- 2
Bringing the Hidden Giants to the Footlight: the Role of Savings and Retail Banks in Increasing the Level of Access to Financial Services docx
Ngày tải lên :
15/03/2014, 10:20
... Thailand has been very active in implementing policies and measures to alleviate and eradicate poverty in the country Individually and in collaboration with other financial institutions and government ... Kenya and Tanzania, people can open a savings account with less than US$10 and an even lower amount in fees is required to keep this account active In other countries and in Latin America and Asia, ... between savings banks and MFIs There are two fields where a closer link between savings banks and MFIs would be directly and mutually beneficial: linking savings to microcredits and linking remittances...
- 4
- 511
- 0
Báo cáo khoa học: " The role of NH4Cl and cysteine proteases in Human Papillomavirus type 16 infection" ppsx
Ngày tải lên :
12/08/2014, 04:21
... NH4Cl bar), a 41.38% and 37.30% decrease in the presence of permeable and non-permeable broad targeting cysteine protease inhibitors (Fig 1, E64 and E64-d bar, respectively), and a statistically ... 2009, 6:109 and the early endosomes (Fig 2A and 2B red) as indicated by the yellow color (Fig 2A and 2B, yellow) We observed a decrease in colocalization between HPV16 (Fig green) and caveolin-1 ... assessed by confocal microscopy and stereology counts Data was collected at minutes post binding for early endosome staining (with goat anti- EEA1, Fig 2A and 2B, red) and hours post binding for caveolin-1...
- 12
- 431
- 0
The Position and role of small and medium enterprises in a national economy – the case of Japan
Ngày tải lên :
01/11/2014, 22:05
... million and million 1991 Between million and 10 million 1999 Between 10 million and 20 million 2001 More than 100 million (excluding between billion and 10 billion) 2002 Between 20 million and 100 ... Labour and Welfare) This means that SMEs have played an important and constant role in employment and have a significant role in social issues Japan is often called “The Country of the Small and ... subcontractor and Keiretu (corporate grouping) in relation to big enterprises Role as supporter of innovation and new industry Role as absorber and creator of employment Role of developing and stabilizing...
- 31
- 743
- 0
Role of allergy and mucosal inflammation in nasal polyps and chronic sinusitis 3
Ngày tải lên :
16/09/2015, 17:13
... correlations between CD56+ NK cells and other inflammatory cells, i.e., CD4+ and CD8+ T cells, eosinophils, neutrophils and mast cells; and of the correlations between NK cells and tIgE or sIgE to common ... neutrophils and mast cells; and to explore its correlation with other medical conditions 3.3 Methodology 3.3.1 Study Patients Patients with nasal polyps and chronic sinusitis, allergic rhinitis and non-atopic, ... Nasal Polyp and Chronic Sinusitis Nasal polyp and chronic sinusitis exhibit chronic inflammation Patients often show recurrent and persistent infection Although the role of CD4+ and CD8+ T cells...
- 133
- 340
- 0
Báo cáo y học: " Role of ADAM and ADAMTS metalloproteinases in airway diseases" pot
Ngày tải lên :
12/08/2014, 14:20
... the zinc ion and the three ligating histidine residues at the catalytic centre of the enzyme [22,23] Structure of ADAMs and ADAMTS is highly conserved and involves metalloproteinase and disintegrin ... health and diseases In this review, we are discussing known and potential implications of ADAMs in lung homeostasis as well as in its deregulation Implication of ADAMs and ADAMTS in physiological and ... -12, -15, -17 and ADAMTS-1, -2, and TS12 has been observed [50] with a modulation of ADAM12 and ADAMTS-1 in tumors [50] In sputum cells, an expression of ADAM-8, -9, -10, -12, -15, -17 and ADAMTS-1,...
- 12
- 319
- 0
Báo cáo khoa học: "Hurricanes Katrina and Rita: role of individuals and collaborative networks in mobilizing/coordinating societal and professional resources for major disasters" pps
Ngày tải lên :
12/08/2014, 23:20
... number and type of medical, social, mental health and related conditions, and the space and personnel required to accomplish this task The planning for these missions took 4–6 hours, and the ... immunizations, and credentialing of volunteer physicians, nurses, and PAs The group also determined to look after the ‘mental health’ of the incident command group and others providing leadership and service ... political, sluggish, and awkward, and often disregard local incident command programs and local resources Top down disaster preparedness concepts have dominated the textbooks and articles on disasters,...
- 6
- 141
- 0
Role of allergy and mucosal inflammation in nasal polyps and chronic sinusitis 2
Ngày tải lên :
16/09/2015, 17:13
... were found between CD4+ T cells and neutrophils, between CD19+ B cells and CD1a+ langerhans cells, and between eosinophils and langerhans cells in nasal polyp tissue and the middle turbinate of 160 ... correlations between CD4+/CD8+ T cells and B cells, between CD4+ T cells/CD8+ T cells/B cells and mast cells, between langerhans cells and mast cells, and between eosinophils and neutrophils Table 13 Significant ... epithelium including hyperplasia of basal cells and goblet cells, and metaplasis of squamous cells; structure change of glands; basement membrane thickening; and edema Figure shows the typical histology...
- 121
- 314
- 0
Role of allergy and mucosal inflammation in nasal polyps and chronic sinusitis
Ngày tải lên :
16/09/2015, 17:14
... polyp tissue and the paired middle turbinate, and middle turbinates from allergic rhinitis patients and controls 194 Table 28 Mean, standard deviation, 95% UCL and 95% LCL of CD4+ and CD8+ T cell ... tissues and the paired middle turbinate (n=48), middle turbinate from allergic rhinitis patients (n=15) and controls (n=14) 201 Table 34 Mean, standard deviation, 95% UCL and 95% LCL of CD4+ and ... scores in nasal polyps and chronic sinusitis 2.5.1 Inflammatory cell scores in nasal polyps and its paired middle turbinate, and middle turbinate of allergic rhinitis patients and controls 2.5.2...
- 162
- 281
- 0
Báo cáo khoa học: Tertiary structure in 7.9 M guanidinium chloride ) the role of Glu53 and Asp287 in Pyrococcus furiosus endo-b-1,3-glucanase pot
Ngày tải lên :
30/03/2014, 04:20
... for metals and two pairs of negatively charged amino acid residues have been assumed to be involved in calcium binding: Glu53 and Asp287, and Glu239 and Glu246 [2] In the present work, and on the ... importance of each vector in U and V The signal-to-noise ratio is very high in the earliest columns of U and V and the random noise is mainly accumulated in the latest U and V columns The wavelength ... intensities are decreased 1.3-fold and 1.2-fold and the maximum emission wavelengths are shifted to 350 nm with E53A and to 356 nm with the double mutant, nm and 13 nm more red-shifted than that...
- 13
- 461
- 0
Tài liệu Báo cáo khoa học: Regulation of DNA fragmentation: the role of caspases and phosphorylation doc
Ngày tải lên :
14/02/2014, 22:20
... regulators and are simultaneously activated p38 MAPK isoforms a, b, c and d have been identified and may have both overlapping and specific functions depending on the cellular context and ⁄ or stimuli ... phosphatase and kinase inhibitors act on identical cell death pathways and eventually induction of DNA fragmentation [26,104] Both OA and ST induce phosphorylation and activation of JNK and p38 MAPK, ... 2441–2451 Alvarado-Kristensson M, Melander F, Leandersson K, Ronnstrand L, Wernstedt C & Andersson T (2004) ¨ p38-MAPK signals survival by phosphorylation of caspase-8 and caspase-3 in human neutrophils...
- 15
- 784
- 0
Tài liệu Báo cáo khoa học: Role of K22 and R120 in the covalent binding of the antibiotic fosfomycin and the substrate-induced conformational change in UDP-N-acetylglucosamine enol pyruvyl transferase docx
Ngày tải lên :
19/02/2014, 13:20
... highlighted in green and the nitrogen atoms of R120 and K22 in blue The open form of MurA is unliganded (A) and the closed conformation (B) contains fosfomycin (orange) and UDPNAG (purple) in ... cloacae MurA (left) and the K22V mutant protein (right) (A and B) Tryptic digest of wild-type MurA and the K22V mutant protein (no additions) (C and D) Wild-type E cloacae MurA and the K22V mutant ... fosfomycin prior to digestion (E and F) Wild-type MurA and the K22V mutant protein incubated with mM UDPNAG and 10 mM fosfomycin prior to digestion (G and H) Wild-type MurA and the K22V mutant protein...
- 9
- 707
- 0
THE FUNDAMENTAL ROLE OF SCIENCE AND TECHNOLOGYIN INTERNATIONAL DEVELOPMENT pptx
Ngày tải lên :
05/03/2014, 12:20
... communications, maintenance and upgrading of water supplies and sanitation facilities, management of natural resources, and energy and environmental services; • Assess the technical and economic merits ... consultations were held with senior officials and specialists from USAID and other U.S government departments and agencies, with local officials and specialists, and with project managers working for ... more robust S&T capabilities And some capability to understand the potential and limitations of S&T, to select and effectively utilize suitable foreign technologies, and to develop local innovations...
- 163
- 440
- 0
Assessing and Managing Rapid Credit Growth and the Role of Supervisory and Prudential Policies docx
Ngày tải lên :
06/03/2014, 08:20
... Bulgaria, Estonia, and Lithuania; horizontal exchange rate bands in Hungary and Slovenia; fixed exchange rates in Latvia, Macedonia, and Ukraine; crawling bands in Belarus and Romania; and tightly managed ... future risks and returns Risks of contagion and owner’s obligation and ability to control such risks Quality of data (transparency) and of supervision and regulation of markets and institutions ... “sleeping beauties” (Albania and Romania, and lately the Czech and Slovak Republics) seem to have woken up, while in “late risers” (Bosnia and Herzegovina, Serbia and Montenegro, and Lithuania), real...
- 59
- 502
- 0
Báo cáo khoa học: Role of DptE and DptF in the lipidation reaction of daptomycin ppt
Ngày tải lên :
07/03/2014, 04:20
... data, which were obtained under ATP and holo-DptF saturation, are presented in Table As expected, the fatty acids (branched and linear, between 10 and 12 carbon units) that are known to be present ... observed that longchain (16 carbon units or more) and short-chain fatty acids (six carbon units or fewer) are not accepted by DptE The observation that DptE is able to activate and transfer a broad ... (Finnzymes, Espoo, Finland) and primers dptF-for (5¢-TATGGATCCAACCCGCCCGAAGCGGTC-3¢) and dptF-rev (5¢-ATAGCGGCCGCGGTGCGGTCGGCC AACTG-3¢) (underlining indicates artificial BamHI and NotI restriction...
- 12
- 674
- 0
The Role of Savings and Wealth in Reducing ―Wilt‖ between Expectations and College Attendance pdf
Ngày tải lên :
15/03/2014, 10:20
... Williams-Shanks and Destin (2009), and Haveman and Wilson (2007) find that net worth has a significant positive relationship with college attendance However, Jez (2008) and Nam and Huang (2009) ... Conley (2001), Destin (2009), Williams-Shanks and Destin (2009), and Haveman and Wilson (2007), it is in line with findings by Jez (2008) and Nam and Huang (2009) Jez (2008) finds that net worth ... real estate, stocks, and other assets, and subtracts out credit card and other debt In this analysis, net worth does not include home equity Net worth is averaged for 1999 and 2001, after 1999...
- 22
- 515
- 0
Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf
Ngày tải lên :
17/03/2014, 23:20
... ACACCATTATGACCAAAAACCAGCCCGGGATA GGC-3¢ The underlined codons code for bF24 and bF57 and were changed to ATA, CCA, AGC and CAA to introduce Tyr, Trp, Ala and Leu, respectively The second set of reactions was carried ... [11,12] Fitting Eqn (4) to the data yielded values for KN of 37 mM and 69 mM and for (Vs/Vh)max of and 10 for the wild-type and bF24A, respectively This indicates that the improved kinetics of ... synthesis of ampicillin and cephalexin using wild-type (dashed lines) and the bF24A mutant (solid lines) (A) Cephalexin synthesis from PGM and 7-ADCA; (B) cephalexin synthesis from PGA and 7-ADCA; (C)...
- 8
- 561
- 0