... traditions, most patients in Sweden with vitamin B12 deficiency are treated with oral vitamin B12, mg daily Objective: Analysis of current state of oral therapy with vitamin B12 in clinical research ... traditions, most patients in Sweden with vitamin B12 deficiency are treated with oral vitamin B12, mg daily Objective: Analysis of current state of oral therapy with vitamin B12 in clinical research ... coworkers in 1964 [3] By 1990, as many patients were treated with tablets as with injections In the period 1990-2000, the Swedish experience with oral vitamin B12 comprised about one million patient...
Ngày tải lên: 24/01/2014, 08:20
... The animals was housed at 25±40 C with 12h light and dark cycle All the mice were divided into two lots, one fed with normal diet (ND from NIHE), other fed with high fat diet (HFD) [4,5] and ... in obese mice treated with STZ (120mg/kg), such as glucose and TG levels increase approximately 2.46 and 4.64 times respectively in comparison with HFD fed mice untreated with STZ It is clear ... injected intraperitoneally (i.p) STZ with dose of 120mg kg-1 (freshly prepared in 0,1M Citrate buffer, pH 4.5) Control lots of ( ND and HFD mice) were injected with the citrate buffer alone 72 hours...
Ngày tải lên: 12/02/2014, 17:20
Báo cáo " Effect of pomelo (citrus grandis (l). osbeck) peel extract on lipid-carbohydrate metabolic enzymes and blood lipid, glucose parameters in experimental obese and diabetic mice " doc
... peels were dried at 500C grinded into powder and extracted times with ethanol with continuously stirring The mixture was filtered with Whatman No.1 filter paper and the filtrate was centrifuged ... with STZ and equivalent to HFD In addition, serum insulin level in HFD mice significantly increase (2.7 times) in comparison with ND fed mice (Table 3) It is clear that, obese mice injected with ... ND: normal diet fed mice injected with citrate buffer (control), ND +STZ: normal diet fed mice injected with STZ (120 mg/kg) HFD: high fat diet fed mice injected with citrate buffer (control), HFD...
Ngày tải lên: 14/03/2014, 10:20
Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"
... GGACAGGCCCATTTGAGTATTTTG Statistical Analysis Data were analyzed with SAS version 11.0 statistical software Comparisons between multiple groups were performed with one way analysis of variance Differences among ... 1212 after stimulation with Hp11638M extract or Hp11638 extract (Fig 2) Moreover, the ROS levels in AGS cells treated with 480 µg/ml and 960 µg/ml Hp11638M extract and with 240 µg/ml, 480 µg/ml ... negative control (P
Ngày tải lên: 25/10/2012, 11:18
Tài liệu Báo cáo khoa học: Angiopoietin-like proteins: emerging targets for treatment of obesity and related metabolic diseases pptx
... circulating ANGPTL2 levels decrease in parallel with reduction of visceral fat in obese diabetic patients treated with pioglitazone, a PPARc agonist with unique antidiabetic activity that decreases ... arteries from smokers with coronary artery disease express higher levels of ANGPTL2 mRNA than tissues from nonsmokers with similar disease [20] Because smoking is closely associated with the development ... (particularly visceral obesity) and correlated with the levels of systemic insulin resistance and inflammation [15] Circulating ANGPTL2 levels decrease with body weight reduction, likely reflecting...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Mechanism of dihydroneopterin aldolase NMR, equilibrium and transient kinetic studies of the Staphylococcus aureus and Escherichia coli enzymes docx
... equilibrated with 20 mm NaH2PO4 made with MilliQ water and eluted at a flow rate of 0.8 mLÆmin)1 with the same solution The oxidized reactant and products were quantified by online fluorimetry with excitation ... and reprotonation occur without the proton exchanging with bulk water However, deprotonation and reprotonation in the aldolase reaction involve the proton exchanging with bulk water [16] The ... same rate constants, in accordance with the crystal structure of the complex of SaDHNA with HP, which reveals that NH at position of HP has no hydrogen bond with the protein [8] and suggest that...
Ngày tải lên: 19/02/2014, 00:20
DNA Replication and Related Cellular Processes Edited by Jelena Kušić - Tišma pdf
... complexes is a specialized version of the replication clamp-loader RFC, with the large subunit replaced by a checkpoint-specific protein Rad24 There is also a checkpoint version of the clamp related ... analysis with the yeasts MCM core is a trimeric complex that forms during purification in result of binding MCM4, MCM6, and MCM7 subunits tightly together MCM2 binds to the core, but with decreased ... stoichiometry of replication origins; they are widely distributed on unreplicated chromatin Analysis of MCM mutant phenotypes and interactions with other factors has now implicated the MCM proteins in other...
Ngày tải lên: 08/03/2014, 19:20
Lecture 3 DNA RNA and protein synthesis great
... WHAT DOES “DNA” STAND FOR? DNA’s proper name isDeoxyribonucleic acid! Consists of a ribose SUGAR with a “missing oxygen” (that’s the de-oxy part) And it’s found in the nucleus of eukaryotic organisms...
Ngày tải lên: 13/03/2014, 16:36
DNA, RNA and proteins
... mutagens • ex: Chemicals, high temperatures, UV light, radiation • Can change the genetic code, and be replicated when forming new body cells • In sex cells, can be passed on to offspring • Mutations...
Ngày tải lên: 13/03/2014, 16:38
Báo cáo khoa học: Cold exposure and associated metabolic changes in adult tropical beetles exposed to fluctuating thermal regimes ppt
... [18] They were either directly correlated with stress tolerance (a causal relationship between Pro levels and stress tolerance was found [3,19]), or with the changes in levels of stress hormones ... [29] For instance, Tenebrionid species supplied with a Lys- and Trp-deficient diet were incapable to sustain growth unless it was supplemented with both amino acids [30] The significant accumulation ... low temperatures In all experiments, beetles were maintained in the darkness and supplied with water but without food It has previously been observed that beetles enter in chill-coma and are thus...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo Y học: Apolipoprotein E predisposes to obesity and related metabolic dysfunctions in mice pdf
... C57BL/6 mice is associated with elevated plasma glucose, insulin and leptin levels Epidemiological and animal studies have established that central obesity is associated with glucose intolerance ... and hypertension in individuals with the metabolic syndrome [39,40] To determine whether the obesity observed in ApoE3knock-in and C57BL/6 mice is associated with FEBS Journal 275 (2008) 4796–4809 ... the ApoE)/) mice (with an average final weight of 25.46 ± 0.55 g) However, it was still significantly lower than the 119.8 ± 7.6% increase observed in the weight of C57BL/6 mice (with an average...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot
... dihedrals The compounds were docked with the QM-polarized ligand docking protocol utilizing Glide version 4.5, qsite version 4.5, jaguar version 7.0 and maestro version 8.5 (Schrodinger ă Inc, Portland, ... interfere with the polymerase catalytic site, impeding the normal RDDP performance Within the NNRTI-binding site, the amino acid residues lysine (Lys103) and tyrosine (Tyr181) interact with many ... function Results showed that, also with this substrate, the newly synthesized derivatives inhibited HIV-1 wild-type RTassociated polymerase-independent RNase H function with IC50 values comparable to...
Ngày tải lên: 22/03/2014, 16:20
Báo cáo khoa học: K182G substitution in DevR or C8G mutation in the Dev box impairs protein–DNA interaction and abrogates DevR-mediated gene induction in Mycobacterium tuberculosis doc
... cooperatively with the P and S sites and that the )35 promoter element partially overlaps with the secondary DevR binding site, S DevR K182G mutant protein is defective for interaction with DNA Fig ... observed with WT DevR protein while no binding was observed with mutant protein up to 1.0 lm concentration (Fig 3B, lanes and 12, respectively) Partial binding of the mutant protein with fdxA ... base does not interact directly with DevR; however, G13 in the complementary DNA strand at this position hydrogen bonds with Lys182 Lys182 also hydrogen bonds with the A12 base in the complementary...
Ngày tải lên: 22/03/2014, 16:20
Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx
... endonucleases and compare it with that of single polyamines, we carried out electrophoretic assays of genomic DNA treated with DNase I Single polyamines or NAPs were allowed to interact with genomic DNA ... engaged in ionic bonds with the phosphates of NAPs, secondary amino groups are those available to establish interstrand interaction with the backbone phosphates In accordance with a recently proposed ... associated with cell replication, being recovered in large quantities in the nuclei of cells in S-phase and absent in non-replicating cells Experimental evidence indicates the NAP with the lowest...
Ngày tải lên: 23/03/2014, 15:20
Methylation - From DNA, RNA and Histones to Diseases and Treatment by Anica Dricu ppt
... hypermethylated [20] On the contrary, promoters of some tissue-specific genes, with low CpG density, are commonly methylated without loss of transcription activity [21,26,30] Many active promoters were ... NF-κB could interact with co-repressors such as Histone deacetylases and (HDAC1 and HDAC2) to suppress gene expression [91,92] and subse‐ quently the HDACs could interact with DNMT1, which gives ... promoting transcription by co-operating with other transcription factors through tandem recognition se‐ quences in promoters as well as by interacting with co-activator proteins [116,118-124]...
Ngày tải lên: 24/03/2014, 02:21
Báo cáo khoa học: DNA binding and partial nucleoid localization of the chloroplast stromal enzyme ferredoxin:sulfite reductase pptx
... DNA-bound PsSiR PsSiR was incubated without (open circles with solid thin line) or with 10 lgÆmL)1 (filled squares with bold solid line) or 20 lgÆmL)1 (filled triangles with dashed line) HindIII digested ... that without a competitor, indicating comparable affinities of SiR for the 20-mer dsDNA and the poly(dI-dC) The k DNA digested with StyI and pea chloroplast DNA digested with XbaI were mixed with ... nonuniformly within the chloroplast The spots that were densely stained with AlexaFluor coincided with the areas of 4¢,6-diamidino-2-phenylindole staining These results indicate that PsSiR exists within...
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA pdf
... was washed for 15 with TBST and incubated with goat anti-mouse IgG conjugated with horseradish peroxidase in 5% milk for h, and then washed three times with TBST and developed with enhanced chemiluminescence ... size markers The expected size of the product with ASAT primers is 132 bp and with S3T primers )160 bp (B, right section) Kinetics of amplification with ASAT primers of identical amounts of cDNA ... overnight at °C with 5% nonfat dry milk in TBST (10 mm Tris ⁄ HCl, pH 8.0 ⁄ 150 mm NaCl ⁄ 0.1% Tween 20) The blot was rinsed twice with TBST and incubated for h at room temperature with rabbit polyclonal...
Ngày tải lên: 30/03/2014, 11:20
Báo cáo khoa học: DNA-binding and transcription characteristics of three cloned sigma factors from mustard (Sinapis alba L.) suggest overlapping and distinct roles in plastid gene expression doc
... right) More dramatic effects were noticeable with either the double mutant M-5–6 T/C–C/A (bottom row, middle) or with M-10 T/A (bottom, left) In contrast with the )35 mutant M-32 G/A (upper right ... bases within the spacer between the )10- and )35-regions In contrast, SASIG3 and r70 seemed to be less dependent on contact sites within this region of the psbA promoter When base changes within ... interact with this specific base position [28] In all three mustard sigma factors there is an HTH motif containing a conserved Arg within region 4.2 (Figs and 7) Because of this similarity with r70...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf
... biophysical studies could be undertaken with a view to understanding the basis of the anticancer activity The thermodynamic parameters of complexation of the drugs with DNA were determined by differential ... drugs and for determing the molecular basis of hetero association with other aromatic ligands and their competitive binding with DNA [14,15] The investigations show that minor modifications in ... relation Materials and methods Drugs and DNA A series of actinomycin derivatives with dimethylaminoalkyl side chains with different numbers of methylene groups (CH2)n, n ¼ 2, 3, 4, and (Fig 1) were...
Ngày tải lên: 31/03/2014, 07:20
chromatin and chromatin remodeling enzymes, part b
... supplemented with approximately physiological concentrations of salts and Mg2þ and small amounts of glycerol; nevertheless, it should be checked, especially in case of problems with the water or with ... Excitation Path Filter Both kinds of scattered light are readily eliminated with appropriate optical filters, with or without the use of an emission monochrometer We use a bandpass interference ... membrane and probed with the fragment-specific probe The second gel is stained with Commassie (GelCode Blue Stain, Pierce) according to the manufacturer’s specifications Slices with 1.5 mm-thickness...
Ngày tải lên: 11/04/2014, 01:17