... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... Real-time TTCCAGTCCCGGTATATGCT Real-time TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...
Ngày tải lên: 16/02/2014, 09:20
... proliferation [1] Limaye et al Comparative Hepatology 2010, 9:9 http://www.comparative-hepatology.com/content/9/1/9 Taken together the findings from this study indicate that the hepatocytes constitute ... are originated from hepatocytes after DAPM treatment The longest time point studied in the present study is 30 days after the DAPM treatment when biliary restoration is still underway It is possible ... study (Figure 6B and 6C) TGFb1 Western blot data indicated increasing trend in both the treatment protocols compared to the controls (Figure 6D), although DAPM + BDL treatment did not show statistical...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: "Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma" docx
... –AAATGTGGGATTTTCCCATGAGTCTCAATATTAGAGTCTCAACCCCCAAT- 3’ Human 5’ -AAATGTGGGATTTTCCCATGAGTCTCAAAATTAGAGAGTTGACTCCTAAT- 3’ Mouse 3’ -AAATGTGGGATTTTCCCATGAGTCTCAAAAGTAGAGAGTCGACTCCCAAT- 5’ Rat CA9 ... -158 –ATTGCTTTAGCTTGGAAATTCCGGAGCTGAAGCGGCCAGCGAGGGAGGAT-ATTGCTTTAGCTTGGAAATTCCGGAGCTGAAGCGGCCAGCGAGGGAGGAT-ATTACTTCAGTTTGGAAATTCCTAGATCGCAGGGGCCAGCGAGGCAGGAC-ATTACTTCAGTTTGGAAATTCCTGGGTCGCAGGGGCCAGCGAGGCAGGAC- ... –CGTACACACCGTGTGCTGGGACACCCCACAGTCAGCCGCATGGCTCCCCT-CGTACACACCGTGTGCTGGGACACCCCACAGTCAGCCACATGGCTCCCCT-CGTCCACAGTGTGTCCTGGGACACCC CAGTCAGCTGCATGGCCTCCCT-CGTCCACACCGTGTCCTGGGACACCC CAGTCAGCTGCATGGCTTCCCT-...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo y học: "Defining and targeting transcription factors in cancer" potx
... was the ability to target transcription factors using drugs Traditionally, transcription factors were generally considered too difficult to target, and kinase pathways or cell surface proteins ... is involved They are currently testing the effectiveness of peptides that target YB-1 René Bernards (Netherlands Cancer Institute) stressed the need to be able to stratify breast cancer patients, ... stapled peptides that target Bcl-2, Bax and BID (proapoptotic proteins containing only the BH-3 motif) One of their inhibitors is about to enter http://genomebiology.com/2009/10/7/311 clinical trials,...
Ngày tải lên: 14/08/2014, 21:20
Tài liệu Báo cáo khoa học: Roles of AP-2 transcription factors in the regulation of cartilage and skeletal development doc
... bric-a-brac domain containing protein KCTD1 directly binds to AP-2a and acts as a negative regulator for AP-2a transactivation [34] It was also demonstrated in other studies that the nuclear protein poly(ADP-ribose) ... conditions [35,36] Little is known about the interaction of AP-2 and its binding partners in cartilage However, at least CBP ⁄ p300-interacting transactivator with ED-rich tail and protein poly(ADP-ribose) ... AP-2e in hypertrophic cartilage and in the development of osteoarthritis also still has to be analyzed in detail It is necessary to obtain more insights into the transcriptional regulation of...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Characterization of the promoter for the mouse a3 integrin gene Involvement of the Ets-family of transcription factors in the promoter activity doc
... several transcription factors including Ets, GATA, and MyoD/E-box binding factors The introduction of mutation into one of the putative Etsbinding sequences suppressed the promoter activity In addition, ... in Fig 8, the introduction of mutation into one of the Ets-binding sequences at )133 (GGAA to GTAA) greatly decreased the promoter activity, whereas mutations in the other Ets-binding site at ... )248 (TTCC to TTAC), the E-box at )241 (CAGGTG to TCGGTG), or the GATAbinding site at )212 (GATA to CTAA) showed no substantial effect Electrophoretic mobility shift assay (EMSA) using the Ets consensus...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx
... Consequently, tyrosines located on the peptides may be expected to exhibit the same kinetics as those located on the intact protein Therefore, determination of the kinetics of phosphorylation of these ... be introduced to the observed phosphorylation kinetics, as its site of binding on TCRf may in uence the ability of its catalytic domain to reach the remaining unphosphorylated tyrosines of TCRf ... our studies using peptides containing single tyrosines show that Lck is capable of phosphorylating all six of the tyrosines without being tethered to the substrate via such phosphotyrosine–SH2...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: NrpRII mediates contacts between NrpRI and general transcription factors in the archaeon ¨ Methanosarcina mazei Go1 pot
... 2-oxoglutarate, resulting in transcription initiation under nitrogen limitation This finding indicates that increasing cellular concentrations of the metabolite 2oxoglutarate provides the intracellular ... 2010 The Authors Journal compilation ª 2010 FEBS for rev for rev for rev AAACGTTGCTGACGTGCACAC CGATATTCTCAAGCCCAAGCC TGATGGAGTCTGGGTTGGAAG AGCCAGATTGATTATGGCCGC ATTCGGACACCCTTGAAAGGG ATAGACAAGTCCGCAGTCCCC ... transcription factors to approximately 20.5% (TBP2) and 36.6% (TFB) Studying potential interactions between MBP–NrpRI and the three TBPs and TFB demonstrated that NrpRI also binds these general transcription...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo y học: "Nuclear transcription factors in mammalian mitochondria" pdf
... disrupted electron-transport chain function [61], which suggests that Stat3 directly regulates mitochondrial function via its effects on the electrontransport chain Engineered Stat3 mutant proteins have ... proteinDNA contacts in mitochondria could become routine [16] In nuclear transcription studies, ChIP is a gold standard for detecting in vivo interactions between a factor of interest and the ... high-throughput sequencing Used to detect direct binding of a factor to mtDNA CREB [40], p53 [54] DNA footprinting Assay of protein-DNA interactions nonspecifically by crosslinking protein to...
Ngày tải lên: 09/08/2014, 20:22
Báo cáo y học: "Immune restoration disease and changes in CD4+ T-cell count in HIV- infected patients during highly active antiretroviral therapy at Zewditu" ppsx
... pulmonary tuberculosis (PTB) and disseminated tuberculosis (DTB) between patients with and without IRD (P > 0.05) The interval between the start of HAART and the onset of Table Baseline characteristics ... nature of our retrospective study Soon after the initiation of HAART, it was observed that some patients presented with initial or recurrent episode of cryptococcal meningitis during the first ... differences in documenting and interpreting data in different settings also might play a role in variation of IRD reports In the study, 1.9% (22/1166) of the patients developed herpes zoster rash with...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Lymphopenia is an important prognostic factor in peripheral T-cell lymphoma (NOS) treated with anthracycline-containing chemotherapy" docx
... patients were treated with anthracycline-containing chemotherapy (e.g., CHOP or CHOPlike regimens) as first-line treatment and 15 (11.3%) were treated without anthracycline-containing chemotherapy ... to predict treatment outcomes or further stratify patients with the same IPI scores Castillo et al reported that a PIT score > and lymphopenia were independent prognostic factors for predicting ... 27.6 months (range, 1.0-69.2 months) Sixty (50.8%) patients died during the follow-up period The rate of treatment-related mortality (TRM) during first-line anthracycline-containing chemotherapy...
Ngày tải lên: 10/08/2014, 21:23
báo cáo khoa học: " Roles of arabidopsis WRKY18, WRKY40 and WRKY60 transcription factors in plant responses to abscisic acid and abiotic stress" doc
... almost no increase in GUS activity following induction of the fusion effector after DEX treatment Thus, SA treatment almost completely abolished the transcription- activating activity of WRKY18 In ... of their expression, DNA binding and transcription- regulating activities strongly suggest that the three WRKY transcription factors form a highly interacting regulatory network that modulates ... transcription- regulating activities The interacting partners of WRKY40 formed during pathogen infection might not be the same as those in ABA-treated plants and, therefore, may function in distinct...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: "Oxygen-sensing mechanisms and the regulation of redox-responsive transcription factors in development and pathophysiology" ppsx
... export NF-κB back to its resting state in the cytoplasm Thick lines indicate the activating pathway; thin lines indicate the inactivating pathway IκB-independent pathways, however, have recently ... leads to increasing intracellular stores of GSSG, a potent inhibitor of NF-κB transcription factor DNA binding The pathway leading to the formation of GSH by the action of γ-glutamylcysteine synthetase ... argued that the key tenets of this model state that there is a universal genetic program that governs cell death at different stages of development, that a variety of stimuli can elicit or activate...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: "Science review: Redox and oxygen-sensitive transcription factors in the regulation of oxidant-mediated lung injury: κ role for nuclear factor-κ" pdf
... are effective in the initiation, stimulation or termination of the genetic transcriptional process [2] While in the cytoplasm, the transcription factor is incapable of promoting transcription A ... demonstrated that the increased in vivo activation of the nuclear transcriptional regulatory factor NF-κB (but not that of NF-IL-6, cAMP-responsive element binding protein [CREB], activating protein-1 ... leads to increasing intracellular stores of GSSG, a potent inhibitor of NF-κB transcription factor DNA binding The pathway leading to the formation of GSH by the action of γ-glutamylcysteine synthetase...
Ngày tải lên: 12/08/2014, 19:21
Báo cáo y học: "Science review: Redox and oxygen-sensitive transcription factors in the regulation of oxidant-mediated lung injury: α role for hypoxia-inducible factor-1α" pptx
... function play a central role in initiating the innate immune system and in activating NF-κB Anti-inflammatory cytokines have the ability to suppress inflammatory processes via the inhibition ... can interact with other transcription factors, and these interactions thereby lead to greater transcriptional selectivity Modification of transcription, and particularly of NF-κB, is likely to ... components that link the availability of oxygen to the activation of these transcription factors are poorly defined, but are broadly believed to hinge on the free abundance of oxidants To study this...
Ngày tải lên: 12/08/2014, 19:21
Báo cáo y học: " Human T-cell leukemia virus type 2 Tax protein induces interleukin 2-independent growth in a T-cell line" ppt
... proteins has a growth promoting activity in T- cells, thus suggesting that this growth promoting activity of Tax2 contributes to HTLV-2-mediated T- cell transformation Since at least two functions, ... 5'-TGTGTCCGTCGTGGATCTGA-3' and 5'-TTGCTGTTGAAGTCGCAGGAG-3' mally activates NFAT, and thus CsA can not inhibit the cell growth of any HTLV-1-transformed T- cell lines [37] NFAT-inducible T- cell ... conferring resistance to CsA in Tax2-transformed CTLL-2 cells In contrast to Tax2, the cell growth of Tax1-transformed cells was little affected by CsA This finding is also consistent with the result...
Ngày tải lên: 13/08/2014, 09:20
Báo cáo y học: "Elevated expression of CD30 in adult T-cell leukemia cell lines: possible role in constitutive NF-κB activation" pps
... sense, 5'-CTGTGTCCCCTACCCAATCT-3' and antisense, 5'-CTTCTTTCCCTTCCTCTTCCA-3'; [65] and for β-actin, sense, 5'GTGGGGCGCCCCAGGCACCA-3' and antisense, 5'-CTCCTTAATGTCACGCACGATTTC-3' Product sizes were ... contributes to constitutive NF-κB activation in ATL cell lines In HTLV-1 transformed cells, NF-κB activation is thought to be largely dependent on Tax1, however it is possible that relatively strong ... likely that this deletion was introduced by incomplete reverse transcription with oligo dT primer during the cDNA library construction process It is interesting to note that none of the other MAP3Ks...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx
... (mut) is mutated at the N-terminus and is therefore still able to bind to cyclins through the C-terminus, making this protein a possible transdominant mutant Finally, to define an inhibitor that ... infected cells exhibited to times more cdk2 kinase activity than uninfected cells To verify that the observed increase in cyclin E/cdk2 kinase activity in HTLV-1 infected cells was not limited to ... associated kinase activity in HTLV-1 infected cells by binding to p16/INK4A, resulting in the inability of p16/INK4A to effectively inhibit cyclin D/ cdk4,6 complexes [57,58] The interaction of Tax...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: " Role of Tax protein in human T-cell leukemia virus type-I leukemogenicity" pps
... HTLV-1 LTR or from other promoters, the strongest activation by Tax is detected with the TATAA box of the HTLV-1 LTR, indicating that this TATAA box contains a specific Tax responsive element ... correspondingly) In contrast to the transient NF-κB activation by external signals, NF-κB factors are constitutively activated by HTLV-1 Tax protein in Tax-expressing and HTLV-1infected cells Reported ... the mounting level of the anti Tax antibodies and cells that still remain with high virus expression are eliminated by the mounting CTLs, this will not stop the remaining mutant cells to further...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: " Regulatory module network of basic/helix-loop-helix transcription factors in mouse brai" doc
... Literature data mining Literature data mining was performed with the web-based tool LitMiner [68] LitMiner is a literature data mining tool that is based on the annotation of key terms in article ... Yeger-Lotem E, Sattath S, Kashtan N, Itzkovitz S, Milo R, Pinter RY, Alon U, Margalit H: Network motifs in integrated cellular networks of transcription- regulation and protein-protein interaction ... be interesting and important to study interactions not only within but also between families However, the amount of public microarray data from brain tissues greatly limits the number of TFs...
Ngày tải lên: 14/08/2014, 08:20