Báo cáo khoa học: NrpRII mediates contacts between NrpRI and general transcription factors in the archaeon ¨ Methanosarcina mazei Go1 pot

NrpRII mediates contacts between NrpRI and general transcription factors in the archaeon Methanosarcina mazei Go ¨ 1 Katrin Weidenbach, Claudia Ehlers, Jutta Kock and Ruth A. Schmitz Institut fu ¨ r Allgemeine Mikrobiologie, Christian-Albrechts Universita ¨ t zu Kiel, Germany Keywords Archaea; Methanosarcina mazei; transcription regulation; NrpR; 2-oxoglutarate Correspondence R. A. Schmitz, Institut fu ¨ r Allgemeine Mikrobiologie, Universita ¨ t Kiel, Am Botanischen Garten 1-9, 24118 Kiel, Germany Fax: +49 (431) 8802194 Tel: +49 (431) 8804334 E-mail: rschmitz@ifam.uni-kiel.de (Received 24 June 2010, revised 3 August 2010, accepted 13 August 2010) doi:10.1111/j.1742-4658.2010.07821.x We report here on the formation of a complex between the two NrpR homologs present in Methanosarcina mazei Go ¨ 1 and their binding proper- ties to the nifH and glnK 1 promoters. Reciprocal co-chromatography dem- onstrated that NrpRI forms stable complexes with NrpRII (at an NrpRI : NrpRII molar ratio of  1 : 3), which are not affected by 2-oxo- glutarate. Promoter-binding, analyses using DNA-affinity chromatography and electrophoretic gel mobility shift assays, verified that NrpRII is not able to bind to either the nifH promoter or the glnK 1 promoter except when in complex with NrpRI. Specific binding of NrpRI to the nifH and glnK 1 promoters was shown to be highly sensitive to 2-oxoglutarate, regardless of whether only NrpRI, or NrpRI in complex with NrpRII, bound to the promoter. Finally, strong interactions between NrpRII and the general transcription factors TATA-binding proteins (TBP) 1–3 and the general transcription factor TFIIB (TFB) were demonstrated, interactions which are also sensitive to 2-oxoglutarate. On the basis of these findings we propose the following: under nitrogen sufficiency NrpRII binds from solu- tion to either the nifH promoter or the glnK 1 promoter by simultaneously contacting NrpRI and TBP plus TFB, resulting in full repression of tran- scription; whereas, under nitrogen limitation, increasing 2-oxoglutarate concentrations significantly decrease the binding of NrpRI to the operator as well as the binding of NrpRII to TBP and TFB, ultimately allowing recruitment of RNA polymerase to the promoter. Structured digital abstract l MINT-7990058: NrpRII (uniprotkb:Q8PVJ4) physically interacts (MI:0915) with TBP3 (uni- protkb: Q8PUZ4)bypull down (MI:0096) l MINT-7989998: NrpRII (uniprotkb:Q8PVJ4) physically interacts (MI:0915) with TBP1 (uni- protkb: Q8PY37)bypull down (MI:0096) l MINT-7989971, MINT-7989984: NrpRII (uniprotkb:Q8PVJ4) physically interacts (MI:0915) with NrpRI (uniprotkb: Q8PXY1)bypull down (MI:0096) l MINT-7990028: NrpRII (uniprotkb:Q8PVJ4) physically interacts (MI:0915) with TBP2 (uni- protkb: Q8PY36)bypull down (MI:0096) l MINT-7990087: NrpRII (uniprotkb:Q8PVJ4) physically interacts (MI:0915) with TFP (uni- protkb: Q977U3)bypull down (MI:0096) l MINT-7990149: NrpRII (uniprotkb:Q8PVJ4) and NrpRI (uniprotkb:Q8PXY1) bind ( MI:0407)bymolecular sieving (MI:0071) Abbreviations EMSA, electrophoretic gel mobility shift assays; IPTG, isopropyl thio-b- D-galactoside; MBP, maltose binding protein; TFB, homologues of the eucaryotic general txn factor FTIIB; TBP, TATA-binding protein. 4398 FEBS Journal 277 (2010) 4398–4411 ª 2010 The Authors Journal compilation ª 2010 FEBS Introduction Global regulatory mechanisms allow microorganisms to survive periods of nutrient starvation or stress resulting from drastic changes in the environment. Besides the regulatory mechanism controlling uptake and metabolism of the carbon sources, the system responsible for regulating uptake and assimilation of different nitrogen sources is of significant importance for surviving under nutrient starvation. Regulation of nitrogen metabolism and regulation of nitrogen fixa- tion in diazotrophes in response to environmental changes – mostly proceeding at the transcriptional and post-translational levels – is well understood in bacte- ria (reviewed in [1–6]). In contrast, still little is known about the global regulation of nitrogen metabolism and nitrogen fixation in archaea. Generally different regulatory mechanisms are expected as the archaeal transcription and translation machineries have many features more similar to their eukaryotic than their bacterial counterparts [7–11]. Within the methanogenic archaea, studies on the regulation of nitrogen metabolism and nitrogen fixa- tion have been pioneered in Methanococcus maripalu- dis. Leigh and coworkers demonstrated that the transcriptional regulation of nitrogen-regulated genes in M. maripaludis differs significantly from that known in bacteria [12–16]. They identified a global nitrogen regulator (NrpR), which binds as a dimer to an opera- tor sequence and inhibits transcription in the presence of sufficient nitrogen [12,17–20]. They further showed that the affinity of NrpR to its operator is modulated by 2-oxoglutarate, resulting in transcription initiation under nitrogen limitation. This finding indicates that increasing cellular concentrations of the metabolite 2- oxoglutarate provides the intracellular signal for nitro- gen limitation [16,21,22], which has also been proposed for a variety of nitrogen sensors and regulators in methanogenic archaea [16,23–25]. Two homologs of NrpR (NrpRI and NrpRII) have been identified in Methanosarcina mazei strain Go ¨ 1 [26], a methylotrophic methanogen of the order Meth- anosarcinales [27–29], which is also able to fix molecu- lar nitrogen [30]. Studies of global gene expression in M. mazei in response to nitrogen, using DNA micro- arrays combined with biochemical and genetic approaches, recently demonstrated that NrpRI repre- sents the global nitrogen regulator in M. mazei and led to the identification of the corresponding operator, which differs from that identified in M. maripaludis [31,32]. However, the function of the second NrpR homolog in M. mazei, which lacks a DNA-binding domain, is not known, and it is thus of specific interest to elucidate whether NrpRII is crucial for nitrogen regulation. There are currently two findings that may indicate a potential modulating function of NrpRII in nitrogen regulation in M. mazei First, an nrpRI mutant strain retained approximately 10% nitrogen regulation compared with the wild-type strain [32] and, second, both NrpR homologs (i.e. an NrpR domain, with or without an N-terminal DNA-binding domain) identi- fied in Methanosarcina acetivorans, a close relative of M. mazei, had to be expressed in trans in order to restore regulated repression in an M. maripaludis nrpR deletion mutant [26]. Thus, the goal of this work was to elucidate the role of NrpRII in nitrogen regulation in M. mazei. Results The presence of two constitutively expressed NrpR homologs in M. mazei, and the observed residual nitro- gen regulation in the absence of the main regulator, NrpRI [32], strongly indicate that NrpRII plays a modu- lating role in nitrogen regulation in M. mazei, poten- tially acting in concert with NrpRI. However, even in the absence of NrpRI, NrpRII appears to inhibit tran- scription of nitrogen-regulated promoters to some extent [32]. Consequently, potential formation of a complex between NrpRI and NrpRII, as well as between NrpRII and general transcription factors, were investigated and the effects of 2-oxoglutarate on binding were analysed. Complex formation between NrpRI and NrpRII In order to study potential interactions between NrpRI and NrpRII, we performed co-chromatography experi- ments using Ni-nitrilotriacetic acid agarose and amy- lose resin to detect complexes between NrpRI with an N-terminally fused maltose binding protein (MBP) (MBP–NrpRI) and NrpRII fused to an N-terminal His-tag [(His) 6 –NrpRII]. MBP–NrpRI and (His) 6 – NrpRII were individually expressed in Escherichia coli, cell-free extracts were prepared and affinity chromatog- raphy using Ni-nitrilotriacetic acid agarose was per- formed as described in the Materials and methods. The elution fractions were analysed by western blotting using antibodies directed against the MBP-fusion and the His-tag to detect MBP–NrpRI and (His) 6 –NrpRII, respectively, clearly demonstrating that significant amounts of MBP–NrpRI co-eluted with (His) 6 –NrpRII from Ni-nitrilotriacetic acid (Fig. 1A). Degradation of MBP–NrpRI into two major products was frequently observed, as was the case for purified MBP–NrpRI K. Weidenbach et al. Role of NrpRII in M. mazei FEBS Journal 277 (2010) 4398–4411 ª 2010 The Authors Journal compilation ª 2010 FEBS 4399 control proteins, and is apparently based upon protein instability. In order to verify formation of the com- plex, complementary co-chromatography was per- formed using the same cell-free extracts, but amylose resin for affinity purification. Western blot analysis confirmed that (His) 6 –NrpRII co-eluted with MBP– NrpRI (Fig. 1B). Control experiments further clearly demonstrated that neither nonspecific binding of MBP–NrpRI to Ni-nitrilotriacetic acid nor nonspecific binding of (His) 6 –NrpRII to the amylose matrix occurred (Fig. 1C), confirming complex formation between NrpRI and NrpRII. Moreover, those com- plexes appear to form independently of an NrpR-regu- lated promoter as the cell extracts were free of DNA. Furthermore, we studied the potential effects of 2-oxoglutarate on the formation of a complex between NrpRII and NrpRI. The respective E. coli cell-free extracts containing MBP–NrpRI and (His) 6 –NrpRII were combined in a 1 : 1 ratio and separated into three equal aliquots. The aliquots were supplemented with 0, 2or10mm 2-oxoglutarate (the aliquot with no 2-oxo- glutarate served as the control). After incubation with Ni-nitrilotriacetic acid agarose and washing the matrix with the respective buffer supplemented with 2-oxo- glutarate according to the incubation conditions, (His) 6 –NrpRII and interacting MBP–NrpRI were eluted in the presence of the respective 2-oxoglutarate concentration (0, 2 or 10 mm 2-oxoglutarate). The pro- tein ratios of the complexes were determined by quan- titative western blot analysis using known amounts of purified proteins. Under all conditions MBP–NrpRI bound to (His) 6 –NrpRII at an NrpRI : NrpRII molar ratio of approximately 1 : 3 (Fig. 2), strongly indicat- ing that the stoichiometry of the NrpRI ⁄ NrpRII com- plexes is not affected by 2-oxoglutarate. Purified MBP–NrpRI and (His) 6 –NrpRII were fur- ther analysed by gel-filtration, which demonstrated that MBP–NrpRI elutes in a single peak corresponding to a molecular mass of > 700 kDa (Fig. S1A left panel). As monomeric MBP–NrpRI has a molecular mass of 70 kDa, the native protein appears to exist in a higher oligomeric conformation, consisting of at least 10 subunits. Analysing MBP–NrpRI in the presence of 10 mm 2-oxoglutarate further indicated that the pres- ence of 2-oxoglutarate may negatively effect the stabil- ity of higher oligomeric NrpRI conformations to some extent (Fig. S1B). Purified (His) 6 –NrpRII eluted in a single elution peak corresponding to a molecular mass of at least 700 kDa, and 2-oxoglutarate had no effect (Fig. S1 CD). Taking the apparent molecular mass of the monomer into account, the eluting (His) 6 –NrpRII appears to be in a complex consisting of more than 23 monomers. Promoter-binding assays In order to analyse specific binding of NrpRI, NrpRII and NrpRI ⁄ NrpRII complexes to nitrogen-regulated A 1 2 3 4 5 6 86 kDa 34 kDa MBP–NrpRI (His) 6 –NrpRII 100 mM 250 mM B 1 2 3 4 5 6 86 kDa 34 kDa MBP–NrpRI (His) 6 –NrpRII C c 1 2 3 4 5 c 1 2 3 4 5 MBP–NrpRI (His) 6 –NrpRII 86 kDa 34 kDa Fig. 1. Co-chromatography of MBP–NrpRI with (His) 6 –NrpRII. (A) (His) 6 –NrpRII in 40 mg of cell extract was immobilized to 1 mL of Ni-nitrilotriacetic acid agarose, and 40 mg of cell extract containing MBP–NrpRI was added. After washing with buffer A containing 20 m M imidazole, (His) 6 –NrpRII and potentially interacting proteins were eluted in the presence of 100 and 250 m M imidazole, each in three 0.5-mL fractions. (B) MBP–NrpRI in 40 mg of crude extract was immobilized to 1 mL of amylose resin, and 40 mg of cell extract containing (His) 6 –NrpRII was added. After washing with MBP buffer, MBP–NrpRI and potential interaction partners were eluted in the presence of 10 m M maltose (in six, 0.5-mL fractions). (C) Controls. Upper panel, 40 mg of crude extract containing MBP– NrpRI was incubated with 1 mL of Ni-nitrilotriacetic acid agarose for 1 h. Wash and elution steps were performed as described for (A). Lower panel, 40 mg of crude extract containing (His) 6 -NrpRI was incubated with 1 mL of amylose resin for 1 h, washed and eluted as described for (B). The elution fractions were analysed by western blotting using antibodies directed against the His-tag and the MBP–fusion. Protein detection and quantification were performed using the ECL Plus system (GE-Healthcare, Munich, Germany), a fluoroimager (DianaIII; Raytest, Straubenhardt, Germany) and the AIDA Image Analyzer, as described in the Materials and methods. (A) Lanes 1–3, elution fractions 1–3 in the presence of 100 m M imidazole; lanes 4–6, elution fractions 4–6 in the presence of 250 m M imidazole. (B) Lanes 1–6, elution fractions 1–6 in the presence of 10 m M maltose. (C) Upper panel: c, 0.5 lg of purified MBP–NrpRI; lane 1, flow-through; lanes 2 and 3, wash fractions; lane 4, combined elution fractions (100 m M imidazole); lane 5, combined elution fractions (250 m M imidazole). Lower panel: c, 0.5 lg of purified (His) 6 –NrpRII; lane 1, flow-through; lanes 2 and 3, wash fractions; lane 4, combined elution fractions 1–3; lane 5, combined elution fractions 4–6. Role of NrpRII in M. mazei K. Weidenbach et al. 4400 FEBS Journal 277 (2010) 4398–4411 ª 2010 The Authors Journal compilation ª 2010 FEBS promoters, promoter-binding assays were performed by DNA affinity chromatography and electrophoretic gel mobility shift assays (EMSAs). Biotinylated PCR products carrying the nifH promoter region containing the operator (ACC-GGCTTCC-GGT) or mutated ver- sions, and the BRE and TATA-box that bind general transcription factors, were linked to streptavidin- coated magnetic beads, as recently described [32]. First, dialysed E. coli extracts containing MBP–NrpRI were incubated with the magnetic beads, and proteins bound nonspecifically were removed from the nifH promoter by several elution steps at low-salt concen- trations (Figs 3 and 4, lanes 1–4). Specifically bound proteins were then eluted in the presence of 1.0 m NaCl (Figs 3 and 4, lanes 5, 6). Western blot analysis of the elution fractions verified that MBP–NrpRI binds specifically to the wild-type operator (ACC- GGCTTCC-GGT) and elutes exclusively in the pres- ence of 1.0 m NaCl (Fig. 3A, lane 6), whereas in the case of the mutated operators M1 (AAA-GGCTTCC- GGT) and M2 (AAA-GGCTTCC-CCT), the majority of MBP–NrpRI eluted at 250 and 500 mm NaCl (Fig. 3A, M1 and M2, lanes 1–4), indicating that bind- ing of MBP–NrpRI is significantly affected by these mutations. The elution of NrpRI from the different operators was quantified and is depicted in Fig. 3B. To determine whether 2-oxoglutarate affects the bind- ing affinity of NrpRI to the operator, promoter-bind- ing assays were performed in the presence of 2- oxoglutarate. Cell extracts containing MBP–NrpRI were supplemented with 2 or 10 mm 2-oxoglutarate, incubated with the magnetic beads coupled to the wild-type nifH promoter, and washing plus elution steps were performed with the buffers supplemented with the respective 2-oxoglutarate concentration. Quantification of NrpRI in the respective elution frac- tions by western blot analysis demonstrated that in the presence of 2 mm 2-oxoglutarate, NrpRI eluted at low salt concentrations (Fig. 3C middle panel, lanes 1–4; and Fig. 3D), indicating that binding of NrpRI to the operator is significantly decreased, whereas no binding at all was obtained in the presence of 10 mm 2-oxo- glutarate (Fig. 3C bottom panel, lanes 1–6; and Fig. 3D). Next, binding of NrpRI to the nifH promoter in the presence of NrpRII was analysed. E. coli cell extracts containing MBP–NrpRI and (His) 6 –NrpRII were com- bined in a 1 : 1 ratio and promoter-binding assays were performed as described above. Western blot anal- ysis demonstrated binding of (His) 6 –NrpRII to the nifH promoter exclusively in the presence of NrpRI (Fig. 4B,C), indicating that NrpRII binds to the opera- tor indirectly by formation of a complex with NrpRI. Furthermore, NrpRI binding to the promoter in MBP–NrpRI (His) 6 –NrpRII c 1 c 2 c 3 123 c 1 c 2 c 3 1 2 3 NrpRII/NrpRI (mol·mol –1 ) Without 2-OG + 2 m M 2-OG + 10 m M 2-OG 0 1 2 3 4 A B Fig. 2. Co-chromatography of MBP–NrpRI with (His) 6 –NrpRII in the presence of 2-oxoglutarate. Sixty milligrams of cell extract containing (His) 6 –NrpRII and 60 mg of cell extract containing MBP–NrpRI were combined and separated into three aliquots. After adding 0, 2 or 10 mM 2-oxoglutarate, the cell extracts were incubated with 0.5 mL of Ni-nitrilotriacetic acid agarose for 1h. Then, the matrix was washed with 10 mL of buffer A containing 20 m M imidazole (control), or 20 mM imidazole + 2 or 10 mM 2-oxoglutarate, and (His) 6 –NrpRII and potentially interacting proteins were eluted in the presence of 250 m M imidazole (1.5 mL) supplemented with the corresponding 2-oxoglutarate concen- trations in three, 0.5-mL fractions. The respective elution fractions 1–3 were combined and analysed by western blotting using antibodies directed against the His-tag and the MBP-fusion. Protein quantification was performed using the ECL-System (GE Healthcare, Mu ¨ nchen, Germany), a fluoroimager (DianaIII, Raytest, Straubenhardt, Germany) and the AIDA Image Analyser. (A) The relative amount of MBP–NrpRI bound to (His) 6 –NrpRII was calculated as described in the Materials and methods. The respective standard deviations of at least two to three independent experiments are indicated. (B) Exemplary original western blotting data. Lanes c 1 –c 3 , 0.125, 0.25 and 0.5 lg of purified (His) 6 – NrpRII (lower panel) and 0.125, 0.25 and 0.5 lg of purified MBP–NrpRI (upper panel); elution in the absence of 2-oxoglutarate (lane 1), and in the presence of 2 m M (lane 2) or 10 mM (lane 3). 2-oxoglutarate. 2-OG, 2-oxoglutarate. K. Weidenbach et al. Role of NrpRII in M. mazei FEBS Journal 277 (2010) 4398–4411 ª 2010 The Authors Journal compilation ª 2010 FEBS 4401 complex with NrpRII was also shown to be highly sen- sitive to 2-oxoglutarate (Fig. 4D). Binding of NrpRI to the operator sequence was fur- ther verified by EMSA, as described in the Materials and methods, using a radiolabeled PCR product of the glnK 1 promoter, including the BRE- and TATA-box, which has been shown to be under direct NrpRI con- trol [32]. As demonstrated for the nifH promoter, puri- fied MBP–NrpRI bound to the glnK 1 –promoter, resulting in a distinct shift of the promoter (Fig. 5A, lanes 3–5; Fig. 5B, lane 2), whereas purified (His) 6 – NrpRII did not (Fig. 5B, lane 1). However, combining MBP–NrpRI (10 lg) with (His) 6 –NrpRII (10 lg) before the analysis resulted in a single second promi- nent shift (Fig. 5B, lane 3), which was not detectable in the presence of exclusively MBP–NrpRI (Fig. 5B, lane 2), further verifying formation of a complex between NrpRI and NrpRII. The presence of 10 mm 2-oxoglutarate significantly decreased the binding of MBP–NrpRI to the operator as well as the binding of the MBP–NrpRI ⁄ (His) 6 –NrpRII complex (Fig. 5B, lanes 4 and 5, respectively). NrpRII binding properties to general archaeal transcription factors To allow more detailed insights into the molecular repression mechanism of nitrogen-regulated promoters, we studied the binding properties of NrpRII to the general transcription factors – TATA-binding protein (TBP) and the archaeal homolog of the eukaryotic general transcription factor TFIIB (TFB). MBP– NrpRII, the three M. mazei (His) 6 –TBPs and (His) 6 – TFB were individually expressed in E. coli and co- chromatography was performed using amylose resin (see the Materials and methods). MBP–NrpRII and potentially interacting (His) 6 -tagged proteins were analysed using quantitative western blotting. Interest- ingly, all three TBPs co-eluted with MBP–NrpRII (Fig. 6A–C), and the molar ratio of the NrpRII : TBP complexes was approximately 1 : 0.6, as exemplarily determined for TBP2 (see Fig. 7). Complex formation between NrpRII and TBPs was further confirmed by retaining the native TBPs from M. mazei cell extracts by Ni-nitrilotriacetic acid-immobilized (His) 6 –NrpRII 12 3 4 5 6 123456 WT WT M1 M1 M2 M2 250 m M 500 m M 1 M NaCl 250 m M 500 m M 1 M NaCl 250 m M 500 m M 1 M NaCl 100% MBP–NrpRI eluting at 1 M NaCl (%) 0 50 100 0 50 100 0 0 0 0 0 0 100% 74.5 ± 1.4% 8.3 ± 1.7% 35.6 ± 1.5% 25.5 ± 1.2% MBP–NrpRI (%) 2 m M 10 m M 2-OG cc 2 c 3 A B [2-OG] D 1 C Fig. 3. DNA affinity chromatography of NrpRI. The nifH promoter (264 bp) or mutant derivatives including the BRE and TATA boxes as well as the operator motifs [wild-type (WT), ACC-GGCTTCC-GGT; mutant 1 (M1), A AA-GGCTTCC-GGT; and mutant 2 (M2), AAA-GGCTTCC-CCT] were coupled to magnetic beads (Dynal, Oslo, Norway). DNA affinity chromatography was performed using crude extracts of Escherichia coli containing MBP–NrpRI, as described in the Materials and methods. (A) Western blot analysis of the respective elution fractions (20 lL) of DNA affinity chromatography (WT, M1 and M2) using antibodies directed against the MBP-fusion. The original data are representative of one single experiment. (B) Quantification of MBP–NrpRI was performed as described in Fig. 1. The amount of MBP–NrpRI bound to the wild- type operator was set to 100%. The respective standard deviations of three independent experiments are indicated. (C) DNA affinity chro- matography was performed in the presence of 2-oxoglutarate. Elution fractions were precipitated with trichloroacetic acid and analyzed by western blotting. Lanes c 1 –c 3 , controls containing 0.125, 0.25 or 0.5 lg of MBP–NrpRI; lanes 1 and 2, elution fractions in the presence of 250 m M NaCl; lanes 3 and 4, elution fractions in the presence of 500 mM NaCl; lanes 5 and 6, elution fractions in the presence of 1 M NaCl. The original data represent the results of a single experiment. (D) Quantification of MBP–NrpRI of three independent experiments. The over- all amounts of MBP–NrpRI eluting in the absence of 2-oxoglutarate [first column (grey) at the respective NaCl concentration], in the presence of 2 m M 2-oxoglutarate [second column (dark) at the respective NaCl concentration, dark] or in the presence of 10 mM 2-oxoglutarate [third column (dark) at the respective NaCl concentration], were set to 100%. 2-oxoglutarate. 2-OG, 2-oxoglutarate. Role of NrpRII in M. mazei K. Weidenbach et al. 4402 FEBS Journal 277 (2010) 4398–4411 ª 2010 The Authors Journal compilation ª 2010 FEBS (data not shown). In addition, complex formation between NrpRII and TFB was demonstrated; however, the interactions between NrpRII and TFB appeared to be weaker, given that NrpRII : TFB molar ratios of 1 : 0.3 were obtained (Fig. 7). Control experiments ruled out the possibility that the three TBPs and TFB bind nonspecifically to the amylose resin in the absence of NrpRII. Co-chromatography with MBP–NrpRII and (His) 6 –GlnK 1 further ruled out that MBP–NrpRII binds specifically to the (His) 6 -tag of a fusion protein (data not shown). These findings confirmed that NrpRII is able to bind all three TBPs efficiently and to bind TFB less efficiently. Finally, the potential effects of 2-oxoglutarate on complex formation between NrpRII and the general transcription factors were studied. In the exponential phase the respective genes of the three TBPs were expressed and induced under nitrogen limitation, as demonstrated by quantitative RT-PCR analysis (see Table 1). Thus, we exemplarily analysed the influence of 2-oxoglutarate on the binding of NrpRII to TBP2 and TFB. As depicted in Fig. 7, the presence of 10 mm 2-oxoglutarate significantly decreased the formation of a complex with NrpRII and either of these transcription factors to approxi- mately 20.5% (TBP2) and 36.6% (TFB). Studying potential interactions between MBP–NrpRI and the three TBPs and TFB demonstrated that NrpRI also binds these general transcription factors, which may occur through the conserved NrpR domains of NrpRI and NrpRII; however, the stoichiometries of the complexes in the case of NrpRI were significantly lower and represented < 2% of the respective NrpRII complexes (data not shown). Discussion NrpRII interacts simultaneously with NrpRI and the general transcription factors We recently demonstrated that the DNA-binding homolog, NrpRI, plays a major role in nitrogen regu- lation, acting as a repressor binding to its operator under nitrogen sufficiency [31,32]. In order to analyse the physiological role of the second NrpR homolog, NrpRII, and elucidate the requirement of NrpRII for full repression of the nitrogen-regulated genes in M. mazei, formation of a complex between NrpRI and NrpRII was investigated. Using two independent approaches, we obtained conclusive experimental evi- dence that NrpRII interacts and forms stable com- plexes with NrpRI in M. mazei. In the first approach, co-chromatography demonstrated that immobilized (His) 6 –NrpRII interacts directly with NrpRI, which was confirmed by reverse co-chromatography (Fig. 1). In the second approach, because of the missing HTH domain, NrpRII is not able to bind to nifH or glnK 1 promoters; however, in complex with NrpRI, binding to nifH and glnK 1 promoters was demonstrated in two independent promoter-binding assays (Figs 4 and 5). Recent in silico analysis revealed that euryarchaeal NrpR homologs exist in three different domain configu- rations (see Fig. S2): one with two tandem NrpR domains fused to an N-terminal HTH domain (e.g. M. maripaludis NrpR); one with a single NrpR domain and an N-terminal HTH domain (e.g. NrpRI of M. mazei and M. acetivorans); and one with a single NrpR domain (e.g. NrpRII of M. mazei and M. acetivo- rans) [20,21,26]. Furthermore, genetic complementation c 1 c 2 c 3 A B C 250 m M 500 m M 1 M NaCl D NrpRI NrpRII NrpRI + NrpRII NrpRI + NrpRII 2-OG c 1 c 2 c 3 c 1 c 2 c 3 c 1 c 2 c 3 1234 56 123456 1 2 3 4 5 6 1 2 3 4 5 6 c 1 c 2 c 3 NrpRI NrpRII NrpRI + NrpRII NrpRI + NrpRII 2 m M 2-OG c 1 c 2 c 3 c 1 c 2 c 3 c 1 c 2 c 3 Fig. 4. Promoter-binding assays using NrpRI and NrpRII. DNA-affin- ity chromatography was performed using the nifH promoter cou- pled to magnetic beads and different cell extracts. (A) DNA-affinity chromatography was performed with crude extracts from Escheri- chia coli containing MBP–NrpRI; elution fractions were analysed by western blotting using antibodies directed against the MBP-fusion. (B) DNA-affinity chromatography using E. coli crude extract contain- ing (His) 6 –NrpRII; the elution fractions were analysed by western blotting using antibodies directed against the His-tag. E. coli cell extracts containing MBP–NrpRI and (His) 6 –NrpRII were combined in a 1 : 1 ratio and analysed by DNA-affinity chromatography in the absence (C) or presence of 2 m M 2-oxoglutarate (D); western blot analysis was performed using antibodies directed against the MBP- fusion (upper panel) or against the His-tag (lower panel). M, pre- stained high-molecular-weight marker (MBI Fermentas, St Leon- Rot, France) Lanes c 1 –c 3 , controls, 0.125, 0.25 or 0.5 lg of MBP– NrpRI and 0.125, 0.25 or 0.5 l g of (His) 6 –NrpRII, respectively; elu- tion fractions in the presence of 250 m M NaCl (lanes 1 and 2), 500 m M NaCl (lanes 3 and 4), 1 M NaCl (lanes 5 and 6). 2-oxogluta- rate. 2-OG, 2-oxoglutarate. K. Weidenbach et al. Role of NrpRII in M. mazei FEBS Journal 277 (2010) 4398–4411 ª 2010 The Authors Journal compilation ª 2010 FEBS 4403 of an M. maripaludis nrpR mutant strain demonstrated that in order to restore regulated repression of the nif promoter, both identified NrpR homologs of M. acetiv- orans had to be co-expressed [26], strongly indicating that both NrpR homologs are simultaneously required to efficiently inhibit RNA polymerase recruitment. Tak- ing those results and our finding of stable complex for- mation between NrpRII and NrpRI into account, we propose that in M. mazei, and presumably also in M. acetivorans, NrpRII takes over the function of the second NrpR domain of M. maripaludis NrpR. We fur- ther hypothesize that preformed NrpRI ⁄ NrpRII com- plexes bind to nitrogen-regulated promoters, or alternatively NrpRII binds from solution to NrpRI already bound to its operator. Both potential mechanisms of NrpRI ⁄ NrpRII com- plex binding to the operator strongly indicate that the general archaeal transcription factors (TBP and TFB) may be involved in tethering NrpRII or the NrpRI ⁄ NrpRII heterooligomeric complex to the pro- moter, which ultimately results in complete inhibition of RNA polymerase recruitment to the promoter. Indeed, we obtained strong evidence by various co-chromatography experiments that NrpRII interacts with the three TBPs present in M. mazei, which are all expressed under nitrogen sufficiency, and interacts in BA c 1 12345 MBP-NrpRI c 1 c 2 1 2 3 4 5 2-OG c 1 12345 MBP–NrpRI c 1 c 2 1 2 3 4 5 2-OG NrpRI NrpRII N rpRI+II N rpR NrpRI+II Fig. 5. EMSAs of the glnK 1 promoter by MBP–NrpRI and (His) 6 –NrpRII. (A) 32 P-labelled DNA fragments (50 ng) of the glnK 1 promoter were incubated without additions (c 1 ) and with purified MBP–NrpRI (2.5, 5, 10, 15 and 20 lg) (lanes 1–5, respectively). (B) Effects of 2-oxogluta- rate: 2 m M 2-oxoglutarate was added to the assays as indicated. c 1 and c 2 , 32 P-labelled glnK 1 promoter, with and without 2-oxoglutarate, respectively; lane 1, 10 lg of (His) 6 –NrpRII; lane 2, 10 lg of MBP–NrpRI; lane 3, 10 lg of MBP–NrpRI + 10 lg of (His) 6 –NrpRII; lane 4, 10 lg of MBP–NrpRI + 2 m M 2-oxoglutarate; and lane 5, 10 lg of MBP–NrpRI, 10 lg (His) 6 –NrpRII + 2 mM 2-oxoglutarate. The original shift assay data are representative of at least three independent experiments. 2-oxoglutarate. 2-OG, 2-oxoglutarate. A MBP–NrpRII (His) 6 –TBP1 86 kDa 25 kDa 1 2 3 4 5 6 7 C (His) 6 –TBP3 MBP–NrpRII 86 kDa 25 kDa 1 2 3 4 5 6 7 B (His) 6 –TBP2 MBP–NrpRII 86 kDa 25 kDa 1 2 3 4 5 6 7 D (His) 6 –TFB MBP–NrpRII 86 kDa 50 kDa 1 2 3 4 5 6 7 MBP–NrpRII (His) 6 –TBP1 86 kDa 25 kDa 1 2 3 4 5 6 7 (His) 6 –TBP3 MBP–NrpRII 86 kDa 25 kDa 1 2 3 4 5 6 7 B (His) 6 –TBP2 MBP–NrpRII 86 kDa 25 kDa 1 2 3 4 5 6 7 D (His) 6 –TFB MBP–NrpRII 86 kDa 50 kDa 1 2 3 4 5 6 7 (His) 6 –TBP2 MBP–NrpRII 86 kDa 25 kDa 1 2 3 4 5 6 7 (His) 6 –TFB MBP–NrpRII 86 kDa 50 kDa 1 2 3 4 5 6 7 Fig. 6. Co-elution of MBP–NrpRII and (His) 6 –TBP or (His) 6 –TFB. Fifty milligrams of cell-free extract containing MBP–NrpRII was combined with 50 mg of cell-free extract containing (His) 6 –TBP1 (A), (His) 6 –TBP2 (B), (His) 6 –TBP3 (C) or (His) 6 –TFB (D) and incubated with 0.5 mL of amylose resin. After washing with MBP-buffer, MBP–NrpRII and potential interacting partners were eluted in the presence of 10 m M malt- ose (seven, 0.5-mL fractions). The elution fractions were analysed by western blotting using antibodies directed against the MBP-fusion (upper panels) and the His-tag (lower panels). (A–D) Lanes 1–7, elution fractions 1–7 in the presence of 10 m M maltose. Role of NrpRII in M. mazei K. Weidenbach et al. 4404 FEBS Journal 277 (2010) 4398–4411 ª 2010 The Authors Journal compilation ª 2010 FEBS addition also with TFB, albeit less efficiently (Fig. 6). This is, to our knowledge, the first report of interac- tions between an archaeal repressor and the general archaeal transcription factors TBP and TFB besides the recent documentation of interactions between the transcriptional activator GvpE and all five TBPs of Halobacterium salinarium [33]. In analogy, these findings suggest that the second NrpR domain of M. maripaludis NrpR also contacts the general transcription factors when bound to its operator via the DNA-binding domain. In a recent genetic approach, Leigh and Lie showed that changing amino acid 390 located in the second NrpR domain of M. maripaludis NrpR (S390A) resulted in a complete loss of repression in M. maripaludis, whereas the muta- tion of the corresponding amino acid in the first NrpR domain (S168A) retained a normal regulation [22]. If the second NrpR domain of M. maripaludis NrpR indeed contacts the general transcription factors, this may indicate that S390 of M. maripaludis NrpR and potentially also the homologus amino acid in M. mazei NrpRII (S92) are essential for the interaction with TBP and ⁄ or TFB. As Methanopyrus kandleri contains a sole NrpR consisting of one single NrpR domain with a N-terminal HTH domain [26], it is of specific interest to elucidate whether the single NrpR domain of M. kandleri is also binding to the general transcrip- tion factors. TBP2/NrpRII (mol·mol –1 ) 12 – + 2-OG 12 + 2-OG c 1 c 2 c 3 1 2 c 1 c 2 c 3 1 2 MBP- NrpRII (His) 6 (His) 6 + 2-OG – + 2-OG c 1 c 2 c 3 1 2 c 1 c 2 c 3 1 2 MBP- NrpRII (His) 6 –TBP2 (His) 6 –TFB A + 2-OG – + 2-OG + 2-OG + 2-OG 12 + 2-OG TFB/NrpRII (mol·mol –1 ) 12 – + 2-OG 0 0.2 0.4 0.6 B 12 + 2-OG 12 + 2-OG 12 + 2-OG 0 0.2 0.4 0.6 12 + 2-OG 12 + 2-OG Fig. 7. Effects of 2-oxoglutarate on complex formation between NrpRII and general transcription factors. Fifty milligrams of crude extract containing MBP–NrpRII was incubated with 50 mg of crude extract containing (His) 6 –TBP2 or (His) 6 –TFB in the absence ()) or presence of 10 m M 2-oxoglutarate (+). To each mixture, 0.5 mL of amylose resin was added. After washing with MBP buffer or MBP buffer containing 10 m M 2-oxoglutarate, MBP–NrpRI and (His) 6 –TBP2 or (His) 6 –TFB were eluted using MBP buffer supplemented with 10 mM maltose in the absence ()) or presence of 10 m M 2-oxoglutarate (+). Pools of the elution fractions 1–4 were analysed by western blotting using antibodies directed against the MBP-fusion (upper panel) and the His-tag (lower panel) (A). Lanes c 1 –c 3 , 0.05, 0.125 or 0.25 lg of MBP–NrpRII and 0.05, 0.125 or 0.25 lg of (His) 6 –TBP2 or (His) 6 –TFB, respectively; lane 1, combined elution fractions 1–4 purified in the absence of 2-oxoglut- arate; and lane 2, combined elution fractions 1–4 purified in the presence of 10 m M 2-oxoglutarate. Protein quantification was performed using the ECL Plus system (see Fig. 1). The relative amount of MBP–NrpRII binding to (His) 6 –TBP2 or to (His) 6 –TFB in the absence or pres- ence of 10 m M 2-oxoglutarate was calculated, and the respective standard deviations of at least three independent experiments are indi- cated (B). 2-oxoglutarate. 2-OG, 2-oxoglutarate. Table 1. Relative transcript levels of MM1028, MM2184 and MM1772 under nitrogen limitation versus nitrogen sufficiency and at different growth phases determined by quantitative RT-PCR analysis. ORF number (according to a previous publication [46]) Protein [46] Fold regulation a N 2 vs. NH 4 þ exponential growth phase Exponential vs. lag phase (NH 4 þ ) Exponential vs. stationary growth phase (NH 4 þ ) MM1028 b MM1027 TBP2 TBP1 2.2 ± 0.3 1.6 ± 0.4 0.8 ± 0.2 MM2184 TBP3 2.1 ± 0.4 1.6 ± 0.5 0.4 ± 0.1 MM1772 TFB 1.1 ± 0.5 2.8 ± 1.6 1.4 ± 0.1 a Data and respective standard deviations are representative of at least three independent experiments. b MM1028 and MM1027 are orga- nized in an operon, as indicated. # K. Weidenbach et al. Role of NrpRII in M. mazei FEBS Journal 277 (2010) 4398–4411 ª 2010 The Authors Journal compilation ª 2010 FEBS 4405 2-Oxoglutarate directly affects NrpRI binding to the operator and NrpRII binding to the general transcription factors Increasing amounts of the intracellular nitrogen metab- olite, 2-oxoglutarate, under nitrogen limitation have been demonstrated to modulate a variety of nitrogen sensors and regulators and have been proposed to provide the intracellular signal for nitrogen limitation in cyanobacteria and methanogenic archaea, microor- ganisms with an incomplete oxidative tricarboxylic acid cycle (TCA) cycle that has excluxively anabolic functions [16,23–25,34,35]. Consistent with this, the binding affinity of M. mazei NrpRI to its operator has been shown to be strongly affected in the presence of 2-oxoglutarate (Figs 3 and 5) potentially resulting in transcription initiation under nitrogen-limiting condi- tions, as recently demonstrated for M. maripaludis NrpR by Leigh and coworkers [21,22]. Moreover, this negative effect of 2-oxoglutarate on binding to the operator was also observed for NrpRI bound to the nifH promoter in complex with NrpRII (Figs 4C,D and 5B), indicating that the 2-oxoglutarate-binding site(s) are still accessible in the NrpRI ⁄ NrpRII com- plex. For M. maripaludis NrpR it was recently shown that both NrpR domains participate and are required for the full 2-oxoglutarate response. Evidence was obtained that the conserved amino acids C148 and L195 located in the first, and C389 and H435 located in the second, NrpR domain are essential for the 2- oxoglutarate response, either by directly binding 2-oxo- glutarate or responding with a conformational change that decreases DNA binding [22]. Thus, it is tempting to speculate that the corresponding amino acids in the two M. mazei NrpR proteins (NrpRI C166 and I213; NrpRII C91 and L138; see Fig. S2) are required for the 2-oxoglutarate response in M. mazei. Moreover, we obtained strong evidence that 2-oxo- glutarate simultaneously affects the binding affinity of NrpRII to the general transcription regulators, ultimately leading to complete dissociation of the hetero-oligomeric NrpRI ⁄ NrpRII complex from the promoter, allowing transcription initiation. Hypothetical model for translational regulation of nitrogen-regulated genes in M. mazei Based on our findings, we propose the following work- ing model of nitrogen regulation in M. mazei, which is depicted in Fig. 8. Under nitrogen sufficiency, NrpRII binds from solution to the nifH promoter by simulta- neously contacting NrpRI and the general transcrip- tion factors, resulting in full repression of transcription. External nitrogen limitation is perceived by sensing the internal concentration of 2-oxogluta- rate, which increases owing to reduced consumption by the ammonium-dependent glutamine synthetase ⁄ glutamine oxoglutarate aminotransferase (GS/GOGAT) way. Under these conditions, the binding of 2-oxoglut- arate to the NrpRI ⁄ NrpRII complex decreases the binding affinity of NrpRI to the operator as well as decreasing the NrpRII binding affinity to the general transcription factors, potentially by inducing a confor- mational change of the protein which ultimately leads to the removal of the NrpRI ⁄ NrpRII complex. This finally allows the recruitment of RNA polymerase to the promoter and transcription initiation. Based on the recent finding that nitrogen-regulated promoters have similar BRE- and TATA-boxes, which differ significantly from the consensus sequence in M. mazei [36], we propose that in the absence of NrpRI, NrpRII is able to inhibit the transcription of N-regulated genes to some extent by binding the general transcription factors from solution and thus TATABRE ACC GGT TBP NrpRI NrpRII TFB RNAP TATABRE ACC GGT TBP NrpRI NrpRII TFB RNAP N 2 ACC GGT TATABRE TBP TFB 2-OG 2-OG NrpRII NrpRI NH 4 + 2-OG 2-OG N 2 TATABRE ACC GGT NrpRII NrpRI N 2 N 2 ACC GGT TATABRE TBP TFB 2-OG 2-OG NrpRII NrpRI ACC GGT TATABRE TBP TFB 2-OG 2-OG NrpRII NrpRI NH 4 + NH 4 + 2-OG 2-OG 2-OG 2-OG N 2 N 2 TATABRE ACC GGT NrpRII NrpRI TATABRE ACC GGT NrpRII NrpRI TFB RNAP TBP TFB RNAP TBP TFB RNAP TBP Fig. 8. Hypothetical model for NrpR-mediated repression in M. mazei. Under nitrogen sufficiency, complexes of NrpRI and NrpRII bind to the operator, inhibiting recruitment of the RNA polymerase (RNAP) thus resulting in repression of transcription. Under nitrogen limitation, increased 2-oxoglutarate (2-OG) levels decrease the binding affinity of NrpRI to the operator as well as the binding affinity of NrpRII to TBP and TFB, ultimately leading to the removal of the NrpRI ⁄ NrpRII complex, allowing RNAP recruitment and transcription. Role of NrpRII in M. mazei K. Weidenbach et al. 4406 FEBS Journal 277 (2010) 4398–4411 ª 2010 The Authors Journal compilation ª 2010 FEBS affecting efficient binding of the general transcription factors to the BRE- and TATA-boxes, resulting in a decrease of RNA polymerase recruitment to the respective nitrogen-regulated promoter. This scenario may explain the residual nitrogen regulation (approxi- mately 10%) in a DnrpRI mutant [32]; however, this has still to be experimentally proven. Materials and methods Strains and plasmids The strains and plasmids used in this study are listed in Table S1. Plasmid DNA was transformed into E. coli according to the method of Inoue [37]. Construction of plasmids pRS236 and pRS524 were constructed as follows. MM1969 encoding NrpRII was amplified from M. mazei genomic DNA using Taq polymerase and primers (5¢-TTA CTGGAGGGTT CATATGC; 5¢-AACAGACTCGAGTTT CAGAC) that added flanking NdeI and XhoI sites (under- lined). The 756-bp PCR fragment was cloned into the NdeI and XhoI sites of the expression vector pET28a (Novagen, Madison, WI, USA) yielding pRS236 and fusing six histi- dine codons in front of the nrpRII start codon (N-terminal His-tag). MM1969 was amplified with the primer set MM1969for (5¢-C CTGCAGTTACTGGAGGGTTG) and MM 1969rev (5¢-GGTTCAAACAGA CTGCAGTTTCAG), which added flanking PstI sites (underlined). The 760-bp PCR fragment was cloned into the PstI site of pMalC2 (New England Biolabs, Ipswich, MA, USA) fusing malE – which encodes the E. coli maltose-binding protein – in front of MM1969. The correct insertion and sequence were con- firmed by DNA sequencing, and the resulting plasmid was designated pRS524. Plasmids for heterologus expression of M. mazei TBPs and the archaeal homolog of the eukaryotic TFB were con- structed as follows: MM1027 (TBP1) and MM1028 (TBP2) coding for two out of the three TBPs present in M. mazei, and MM1772 coding for TFB, were amplified from chro- mosomal DNA using the primer sets (Mm1027 His.for 5¢-GGGTGGA CATATGAGCGAATC ⁄ Mm1027 His.rev 5¢-GTTTG AAGCTTTTATAAAAGACCCATAC; Mm1028 His.for 5¢-GGTTGA CATATGAGCGAATC ⁄ Mm1028 His. rev 5¢-G AAGCTTCTTATAAAAGCCCC; and Mm 1772 His.for 5 ¢-GGTGATAT CATATGGTAGAAGTCG ⁄ Mm 1772 His.rev 5¢-GAAGA AAGCTTTAGAGGATAATCTCG) add- ing flanking NdeI and HindIII sites (underlined). The 550- bp TBP fragments and the 1040-bp TFB fragment were cloned into the NdeI and HindIII sites of the expression vector pET28a. This resulted in fusing six histidine codons upstream of the respective genes, ultimately resulting in an N-terminal His-tag. The obtained plasmids were designated pRS475 (MM1027), pRS231 (MM1028) and pRS476 (MM1772). MM2184 (TBP3) was amplified using primers (Mm 2184 His.for 5¢-CCAAATACA GGATCCATGGA- ATCTAC and Mm 2184 His.rev 5¢-GA GAATTCATTT- AATAAAGAAGTCCTAAG) that added flanking BamHI and EcoRI sites and facilitated cloning the 580-bp fragment into the BamHI and EcoRI sites of pET28a, fusing six histidine codons in front of MM2184. The resulting plasmid was designated pRS469. Correct insertions and sequences were in general confirmed by DNA sequencing of both strands. Cell extracts and protein purification For heterologus expression and purification of M. mazei (His) 6 –NrpRII, pRS236 was transformed into E. coli BL21- CodonPlus Ò -RIL (Stratagene, La Jolla, CA, USA). One- liter cultures were grown aerobically in Luria–Bertani (LB) medium at 37 °C, and expression of His–NrpRII was induced with 100 lm isopropyl thio-b-d-galactoside (IPTG) respectively, when cells reached a turbidity of 0.6 at 600 nm. After a 2 h induction at 37 °C, the cells were harvested and cell extracts were prepared by disruption in buffer A (50 mm NaH 2 PO 4 , 300 mm NaCl, pH 8.0), supple- mented with the protease inhibitor cocktail for bacterial cell extracts (Sigma, Mu ¨ nchen, Germany), using a French pres- sure cell at 4135 · 10 6 NÆm )2 , followed by centrifugation at 20 000 g for 30 min. (His) 6 –NrpRII was purified from the supernatant by Ni-affinity chromatography using Ni-nitrilo- triacetic acid agarose (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. (His) 6 –NrpRII was eluted from Ni-nitrilotriacetic acid agarose in the presence of 100 and 250 mm imidazole, dialysed into buffer A and stored at -70 °C. One-liter cultures of E. coli BL21-CodonPlus Ò -RIL ⁄ pRS454 were grown in LB medium, and synthesis of MBP– NrpRI was induced from pRS454 [32] for 2 h with 100 lm IPTG at a turbidity of 0.6 at 600 nm. MBP–NrpRI was purified by amylose affinity chromatography, as described by Weidenbach et al. [32]. Samples of each purification step were analysed by 12.5% SDS ⁄ PAGE, according to Laemmli [38], and protein concentrations were determined via the method of Bradford [39] with the Bio-Rad Labora- tories (Bio-Rad Laboratories GmbH, Mu ¨ nchen, Germany) protein assay using BSA as the standard. Complex analysis by gel filtration For gel filtration, an analytic Superdex 200 column (GE Healthcare, Mu ¨ nchen, Germany) and buffer A (50 mm Tris ⁄ HCl, 150 mm NaCl, pH 8.0) were used; proteins were detected by monitoring the absorbance at 280 nm. Protein was eluted from the column using a flow rate of K. Weidenbach et al. Role of NrpRII in M. mazei FEBS Journal 277 (2010) 4398–4411 ª 2010 The Authors Journal compilation ª 2010 FEBS 4407 [...]... maltose in 3 mL (in six, 0.5 mL fractions) Aliquots of the wash and elution fractions of both co-chromatography experiments were analysed by western blotting In order to study the effects of 2-oxoglutarate on complex formation between NrpRI and NrpRII, 60 mg of cellfree cell extract containing (His)6 NrpRII and 60 mg of 4408 cell-free cell extract containing MBP NrpRI were combined and separated into... immobilizing MBP– NrpRI from 40 mg of cell-free cell extract to 1 mL of amylose resin (New England Biolabs, Ipswich, MA, US) for 30 min at 4 °C Then, 40 mg of cell-free cell extract containing (His)6 NrpRII was added and further incubated for 1 h at 4 °C The matrix was washed twice with 10 mL of MBP–buffer (see above) followed by elution of MBP– NrpRI and potentially interacting proteins in the presence...Role of NrpRII in M mazei K Weidenbach et al 0.5 mLÆmin)1, and 0.5-mL fractions were collected Calibration of the column was performed using the gel-filtration mass standard (Bio-Rad Laboratories) containing thyroglobulin (670 kDa), IgG (158 kDa), ovalbumin (44 kDa), myoglobulin (17 kDa) and vitamin B12 (1.35 kDa) Fifty nanograms of purified MBP NrpRI, or 50 lg of purified (His)6 NrpRII, in the absence... unbound protein with 10 mL of MBP buffer, MBP NrpRII and potentially interacting (His)6-tagged proteins were eluted in the presence of 10 mm maltose (7 · 0.5 mL) and analysed by western blotting No difference in complex formation was obtained when MBP NrpRII from 50 mg of cell-free extracts was first immobilized to amylose resin and extensively washed before adding 50 mg of cell extract containing the respective... MBP NrpRII, the three (His)6– TBPs and (His)6–TFB were individually expressed in E coli BL21-CodonPlusÒ-RIL and the respective cell-free extracts were prepared as described above Fifty milligrams of cellfree extract containing MBP NrpRII was combined with 50 mg of cell-free extracts containing (His)6–TBP (1–3) or (His)6–TFB and incubated with 0.5 mL of amylose resin for 60 min at 4 °C After removing... proteins were eluted from the column in the presence of 100 mm (1.5 mL) and 250 mm (1.5 mL) imidazole supplemented with the corresponding concentrations of 2-oxoglutarate in 0.5-mL fractions The respective elution fractions 1–3 were combined and analysed by western blotting Potential complex formation between MBP NrpRII and the three TBPs and TFB was analysed by affinity chromatography on amylose resin... loaded onto the Supderdex 200 column and eluted with buffer A alone or buffer A supplemented with 10 mm 2-oxoglutarate, respectively In order to analyse complex formation between NrpRI and NrpRII, 50 lg of purified MBP NrpRI and 50 lg of purified (His)6 NrpRII were incubated in a total volume of 200 lL of buffer A for 10 min at room temperature before applying to the column When analysing the effect of... applied to the Ni-nitrilotriacetic acid agarose (Qiagen, Hilden, Germany) and incubated for 1 h at 4 °C with slow shaking Then, unbound protein was washed from the columns two times with 8 mL of buffer A supplemented with 20 mm imidazole, followed by elution of (His)6 NrpRII and potentially interacting proteins in the presence of 100 mm (in three, 0.5 mL fractions) and 250 mm imidazole (in three, 0.5... concentration) and the third aliquot was used as a control (C) After the addition of 0.5 mL Ni-nitrilotriacetic acid agarose to each aliquot, the binding assays were incubated for 1 h at 4 °C in a column After washing the resin with 10 mL of buffer A containing 20 mm imidazole (C), 20 mm imidazole + 2 mm 2-oxoglutarate (A) or 20 mm imidazole + 10 mm 2-oxoglutarate (B), (His)6 NrpRII and potentially interacting... a maximum of 7 days Directly before incubation with cell-free cell extracts containing MBP– NrpRI or (His)6 NrpRII, the coupled Dynabeads were equilibrated with 400 lL of binding buffer [10 mm Tris ⁄ HCl (pH 7.5), 1 mm EDTA, 1 mm dithiothreitol] for 2 min Cells of 1-L cultures containing MBP NrpRI or (His)6 NrpRII (see above) were disrupted in 4 mL of protein-binding buffer [100 mm NaCl, 20 mm Tris . to the NrpRI ⁄ NrpRII complex decreases the binding affinity of NrpRI to the operator as well as decreasing the NrpRII binding affinity to the general transcription factors, potentially by inducing. NrpRII mediates contacts between NrpRI and general transcription factors in the archaeon Methanosarcina mazei Go ¨ 1 Katrin Weidenbach, Claudia Ehlers, Jutta Kock and Ruth A. Schmitz Institut. studied the binding properties of NrpRII to the general transcription factors – TATA-binding protein (TBP) and the archaeal homolog of the eukaryotic general transcription factor TFIIB (TFB). MBP– NrpRII,