2 factors that might influence the disposition of records
What Will Influence the Future of Alternative Medicine? A WORLD PERSPECTIVE doc
Ngày tải lên :
15/03/2014, 09:20
... for TSH, and the current status and use of these TSH is predominantly the result of political factors In the current context, there are several factors that influence the choice of Indians towards ... to be solved To take the Theory of Five Elements as an example, some of the explanations of the theory seem far-fetched In modern society, the integration between the theory of TCM and modern science ... in development of TCM 2. 2 Anticipated Breakthrough in the TCM Theoretic System The theoretic system of TCM is established on the basis of Chinese classical philosophy Many of its theories such...
- 142
- 365
- 0
Coaching That Counts Harnessing the Power of Leadership Coaching to Deliver Strategic Value pdf
Ngày tải lên :
24/03/2014, 00:21
... Increased 26 2 Four Examples of Monetary Value: Completing the Case Studies of Section One 26 3 Coaching That Counts 26 8 References and Further Reading 27 1 About the Authors 27 3 Index 27 7 Foreword ... take them there The second part of this book shifts to the analytic aspect of coaching We take a hard look at these coaching relationships and make sure they are delivering the kind of value that ... Coaching That Counts The change is targeted to meet the development needs of the individual and the strategic needs of the organization Both the coach and the client need to be looking at the big...
- 304
- 354
- 3
Báo cáo khoa học: "A MODEL OF PLAN INFERENCE THAT DISTINGUISHES BETWEEN THE BELIEFS OF ACTORS AND OBSERVERS" pot
Ngày tải lên :
31/03/2014, 17:20
... Models of the question-answering process often include a claim that the respondent (R) must infer the plans of the questioner (Q) So R is the observer, and Q the actor Building on the analysis of ... t2,tl), for i = ,n-1 The left-hand side of (P1) denotes that the agent G has, at time tl, a simple plan to an, consisting of doing the set of acts { e l , , a n - l } at t2 Note that all these ... invalid, s The type of any invalidities, defined in terms of the clauses of (PI) that contain the discrepant beliefs, can be shown to influence the content of a cooperative response However, they not...
- 8
- 232
- 0
coaching that counts harnessing the power of leadership coaching to deliver strategic value 2005
Ngày tải lên :
04/06/2014, 13:20
... Increased 26 2 Four Examples of Monetary Value: Completing the Case Studies of Section One 26 3 Coaching That Counts 26 8 References and Further Reading 27 1 About the Authors 27 3 Index 27 7 Foreword ... take them there The second part of this book shifts to the analytic aspect of coaching We take a hard look at these coaching relationships and make sure they are delivering the kind of value that ... Coaching That Counts The change is targeted to meet the development needs of the individual and the strategic needs of the organization Both the coach and the client need to be looking at the big...
- 304
- 310
- 0
Báo cáo lâm nghiệp: "Morning, noon, or afternoon: does timing of direct radiation influence the growth of Picea abies seedlings in mountain forests?" pptx
Ngày tải lên :
08/08/2014, 00:22
... by a canopy of mature P abies [2] We did not, therefore, include the red:far red ratio in our study By means of a field experiment, we tested the hypothesis that the time of day of exposure to ... than the expected mean by –0.6 °C, and the temperatures in 20 02 were warmer by 0.4 °C 3 .2 Performance of sunlight exposure treatments The analysis of the hemispherical photographs showed that the ... during the whole growing season than in the ‘control’ treatment This should be seen in the context of an average clouding of about 60–70% on the site in the years 20 01 and 20 02 during summer [14] The...
- 9
- 266
- 0
Báo cáo y học: " Factors that may mediate the relationship between physical activity and the risk for developing knee osteoarthritis" pot
Ngày tải lên :
09/08/2014, 10:22
... Arthritis Research & Therapy 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 Vol 10 No Urquhart et al cal activity is not associated with knee osteoarthritis: the Framingham Study ... OA regardless of the level of physical activity that they performed (low or moderate/high) Potential roles of mediating factors Age A number of studies have examined the influence of age on risk ... Research & Therapy Other studies that have examined the effect of body composition and knee joint structure have demonstrated that fat mass may be one of the determinants that mediate the association...
- 10
- 310
- 0
Báo cáo y học: "Inflammatory Signals shift from adipose to liver during high fat feeding and influence the development of steatohepatitis in mice" pot
Ngày tải lên :
11/08/2014, 03:20
... (3) 21 (2) 1.1 leptin, ng/ml 43 (10)* 0.5 (0 .2) 86 22 (6)* (1) 5.5 46 (8)* 17 (3) 2. 7 MCP-1, pg/ml 32 (2) * 26 (2) 1 .2 36 (2) * 23 (2) 1.6 3 02 (26 )* 134 (8) 2. 3 IL-6, pg/ml (1) (1) 1 .2 25 (6)* 12 ... 1 .2 25 (6)* 12 (2) 2. 1 33 (9)* 17 (5) 1.9 KC, pg/ml 32 (2) 21 (1) 1.5 67 (4) 44 (8) 1.5 98 ( 12) * 45 (4) 2. 2 IL-10, pg/ml 15 (2) 27 (6) 0.6 124 (43) 47 (6) 2. 6 45 (17)* 17 (6) 2. 6 serum amyloid ... 10 .24 (0 .25 ) 8. 52 (0 .25 ) 1 .2 15.13 (0.54) 14.04 (0.46) 1.1 11.35 (0 .28 ) 11.54 (0.34) 1.0 insulin, pmol/l HOMA 41.96 (2. 81)* 28 .85 (6.17) 3.19 (0 .24 )* 1. 92 (0.47) 1.5 1.7 436.49 (86.01)* 74 .22 ...
- 14
- 336
- 0
Báo cáo y học: "An exploration of how clinician attitudes and beliefs influence the implementation of lifestyle risk factor management in primary healthcare: a grounded theory study" pot
Ngày tải lên :
11/08/2014, 05:21
... the American Pharmacists Association 20 06, 46:364-369 http://www.implementationscience.com/content/4/1/66 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 Stange K, Flocke S, ... but part of the process; judged the effectiveness of their intervention in terms of the process of change rather than achieving behavioural targets, considering their intervention as one of many ... part of our role.' (Clinician 23 ) Overall, the broader clinicians' perspective of the relevance of lifestyle issues to their role, the more they were willing to invest time in addressing them These...
- 15
- 708
- 0
Báo cáo y học: "Inflammatory Signals shift from adipose to liver during high fat feeding and influence the development of steatohepatitis in mice" pptx
Ngày tải lên :
11/08/2014, 06:22
... (3) 21 (2) 1.1 leptin, ng/ml 43 (10)* 0.5 (0 .2) 86 22 (6)* (1) 5.5 46 (8)* 17 (3) 2. 7 MCP-1, pg/ml 32 (2) * 26 (2) 1 .2 36 (2) * 23 (2) 1.6 3 02 (26 )* 134 (8) 2. 3 IL-6, pg/ml (1) (1) 1 .2 25 (6)* 12 ... 1 .2 25 (6)* 12 (2) 2. 1 33 (9)* 17 (5) 1.9 KC, pg/ml 32 (2) 21 (1) 1.5 67 (4) 44 (8) 1.5 98 ( 12) * 45 (4) 2. 2 IL-10, pg/ml 15 (2) 27 (6) 0.6 124 (43) 47 (6) 2. 6 45 (17)* 17 (6) 2. 6 serum amyloid ... 10 .24 (0 .25 ) 8. 52 (0 .25 ) 1 .2 15.13 (0.54) 14.04 (0.46) 1.1 11.35 (0 .28 ) 11.54 (0.34) 1.0 insulin, pmol/l HOMA 41.96 (2. 81)* 28 .85 (6.17) 3.19 (0 .24 )* 1. 92 (0.47) 1.5 1.7 436.49 (86.01)* 74 .22 ...
- 14
- 306
- 0
Báo cáo khoa hoc:" Host factors do not influence the colonization or infection by fluconazole resistant Candida species in hospitalized patients" ppsx
Ngày tải lên :
11/08/2014, 07:21
... Catheter insertion Mortality Total % number % number % p value 80 59 21 39 58 57 43 60 91 75 25 43.3 72. 5 64.8 48.9 68 .2 32 23 17 22 22 19 23 91 71 .2 28.8 48.6 62. 9 62. 9 54.3 65.7 48 36 12 22 ... 88 20 .5 86.4 11.4 4.6 79.6 43 .2 100 29 28 16 35 20 .0 82. 9 20 2. 9 80.0 45.7 100 11 47 3 42 22 53 20 .8 88.7 5.7 5.7 69.3 41.5 100 0.93 0.53 0.05 0.65 0.85 0.87 group was 2. 5-fold higher than that ... Colonization of human immunodeficiency Page of (page number not for citation purposes) Journal of Negative Results in BioMedicine 20 08, 7: 12 10 11 12 13 14 15 16 17 18 19 20 21 22 23 virus-infected...
- 5
- 295
- 0
Báo cáo y học: "Does improvement management of atopic dermatitis influence the appearance of respiratory allergic diseases? A follow-up study" ppsx
Ngày tải lên :
13/08/2014, 13:22
... Present 21 29 %(18.4-39 .2) 12% (4.8-19.9) Absent 130 54 27 21 52% ( 42. 8- 62. 1) Food sensitization 103 30 41% (29 .8- 52. 4) (specific IgE > 0.35 KU/L) 26 %(17.7-34.7) 20 %( 12. 6-38 .2) Present 39 24 30% (22 ,1-37,9) ... appearance 42 Present 12 27%(18.9-36,8) 12, 4%(5,8-18,9) Absent 42 145 21 18 53 ,2% ( 42, 2-64 ,2) Hen's egg sensitization 79 27 43,3%(33,4-53 ,2) (specific IgE > 0.35 KU/L) 26 ,6%(16,8-36,3) 22 ,8%(13,5- 32, 0) ... Allergy 20 10, 8:8 http://www.clinicalmolecularallergy.com/content/8/1/8 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 Hanifin JM, Rajka G: Diagnostic features of atopic...
- 12
- 155
- 0
Báo cáo y học: "Clinical review: Intra-abdominal hypertension: does it influence the physiology of prone ventilation" doc
Ngày tải lên :
13/08/2014, 21:20
... http://ccforum.com/content/14/4 /23 2 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 prone position on inflammatory markers in patients with ARDS due to community-acquired pneumonia J Formos Med Assoc 20 07, 106:708-716 ... on PV: the role of the Kirkpatrick et al Critical Care 20 10, 14 :23 2 http://ccforum.com/content/14/4 /23 2 thoracoabdominal cavity as a complete entity, and the lack of appreciation for the relationship ... therefore speculate that, in general, the greater the abdominal distension (larger IAV), the higher the BMI – and that the higher the IAP, the more important it is to ensure that the visceral abdominal...
- 11
- 318
- 0
Báo cáo y học: "Acute fluid shifts influence the assessment of serum vitamin D status in critically ill patients" pps
Ngày tải lên :
14/08/2014, 07:21
... elevated 1a ,25 (OH)2D3 levels through extra renal production of 1a ,25 (OH)2D3 [19] Alterations in VDBP are known to influence monocyte responses to 25 (OH)2D3 and 1a ,25 (OH)2D3 [20 ] Whether it played ... examined 25 (OH)D3 , while the active hormone is 1a ,25 (OH) 2D Whether changes in 1a ,25 (OH)2D3 parallel those of 25 (OH)D3, during volume loading and clearance also remain unknown Of note, the water-solubility ... serum 25 (OH)D3 and 1a ,25 (OH)2D3 These may take up to 24 hours to resolve The magnitude of changes in 25 (OH)D3 and 1a ,25 (OH)2D3 appeared to be proportional to the extent of volume change Based...
- 7
- 372
- 0
Báo cáo y học: "Identification of motifs that function in the splicing of non-canonical introns" doc
Ngày tải lên :
14/08/2014, 20:22
... GTGAGTGTCTCTGCGGATGACCGGCTTGGGGTGGGGCAGGTGCCCCAGACCCCAGCTGCCCTGACCCCTTCCACCCGCTGCAG GRM1 GRM2 CRM1 CRM2 BPS (b) MUT3 MUT7 MUT6 MUT27 MUT28 MUT29 5 5±1 19±5 23 ±1 19±3 12 3 10±1 5±3 Percentage of pre-mRNA (c) WT 25 20 15 10 WT MUT3 MUT7 MUT6 MUT27 MUT28 MUT29 Figure G-rich ... MUT20 MUT48 MUT49 MUT16B Figure Strengthening the PY tract eliminates the role of the C-rich motifs Strengthening the PY tract eliminates the role of the C-rich motifs (a) LCAT intron with the ... suggesting that the presence of the mutant AAA sequence in that region of LCAT intron does not act as an ISS These results suggest that GRM1 and GRM2 are ISEs important for the splicing of LCAT...
- 17
- 229
- 0
A SIRNA SCREEN TO PROBE FOR HYDROXYLASES THAT CAN MODULATE THE REPLICATION OF DENGUE VIRUS
Ngày tải lên :
26/09/2015, 09:56
... well-established 22 ,6 32 double-stranded RNA library Of the 116 candidates identified, most of the host factors were newly implicated in the propagation of dengue virus, and 82 of the factors had readily ... cocktail mix Next, 25 µL of the cocktail was then transferred into the individual well of the 96-well plate of the PCR array, and the recommended thermal cycling profile was run on the Applied Biosystems™ ... concentrations of Co(II)Cl2 and Fe(II)Cl2 for 24 hours before infection with DENV2 (NGC) at MOI of The infected cells were then incubated at 37oC with 5% CO2 for another 72 hours before harvesting the infection...
- 153
- 177
- 0
A STUDY ON FACTORS THAT AFFECT ON THE FIXED BED GASIFICATION PROCESS NGHIÊN cứu một số yếu tố ẢNH HƯỞNG đến QUÁ TRÌNH KHÍ hóa TRẤU TẦNG cố ĐỊNH
Ngày tải lên :
14/01/2016, 15:28
... dirt 2. 2 Main reaction equations in gasification In most of the cases, the following chemical reactions may take place in the gasification process: C + O2 CO2 (1) 2H2 + O2 2H2O (2) C + 1/2O2 CO ... 3,397.68 421 .31 12. 40 7.03 3,397.68 356.76 10.50 8. 52 3,397.68 3 12. 59 9 .20 10.06 3,397.68 29 9.00 8.80 4 .2 Effect of humidity husk The dependence of the process efficiency on humidity of input ... CO2 (1) 2H2 + O2 2H2O (2) C + 1/2O2 CO (3) C + 2H2 CH4 (4) CO + 3H2 CH4 + H2O (5) CO2 + H2 CO + H2O (6) C + CO2 2CO –164,9 (7) C + H2O CO + H2 (8) EXPERIMENT MODEL AND METHODOLOGY 3.1 Experiment...
- 6
- 298
- 0
THE BASICS OF RECORDS MANAGEMENT docx
Ngày tải lên :
31/03/2014, 13:20
... Program is part of the Division of Library and Information Services of the Department of State The Secretary of State is the official holder of the Great Seal of the State of Florida and official recordkeeper ... unless the head of the agency that has custody of the records certifies that the records shall be retained in the agency’s custody for use in the conduct of the regular current business of the agency ... the records has been started before the expiration of the retention period and the disposition of the records, the records must be retained until completion of the action and resolution of all...
- 54
- 597
- 0