... Ala reverse GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC ... TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC ... commercial antibody directed against the cytoplasmatic tail of b-DG (upper panel) and with antisera against EGFP (middle panel) Anti-actin serum was used as loading control (lower panel) upstream,...
Ngày tải lên: 16/03/2014, 12:20
... would also like to thank Daniela Favaretto, Jean-Loup Florens, Annie Luciani, Hans-Joachim Maempel, Stefan Weinzierl, and the Alexander von Humboldt Foundation for their assistance References M Mathews, ... Digital Audio Effects (DAFx-10) Graz (Austria, 2010) 36 T Dang, T Annaswamy, M Srinivasan, Development and evaluation of an epidural injection simulator with force feedback for medical training, ... employ a computable mechanical analog model of a neural oscillator for implementing force–feedback interaction A linear-only version of the mechanical analog model was proposed earlier by Claude Cadoz...
Ngày tải lên: 21/06/2014, 17:20
BÀI LUẬN TIẾNG ANH HAY describe an encounter with a stranger
Ngày tải lên: 20/08/2015, 00:38
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript Competing interests The authors...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"
... on performance Acta Anaesthesiol Scand 2010, 54(6):689-695 Handbooks of the Ministry of Social Affairs and Health Ambulance and emergency care services: A handbook for drawing up an alarm procedure ... in East and Central Uusimaa, an area of southern Finland where the EMCC covers about 300 000 inhabitants We identified performance indicators and compared them with data collected before and after ... There was no organized collection of data that could allow for a structured evaluation of the organizational changes It is evident that a well-planned evaluation of changes in the organizations,...
Ngày tải lên: 25/10/2012, 10:02
Gián án TestEL 9 - A 18
... ->…………………………………………………………………………… A man was arrested later that night ->…………………………………………………………………………… They took the old man to the hospital ->…………………………………………………………………………… They were repairing the traffic lights yesterday ->…………………………………………………………………………… ... school has been pulled down ->………………………………………………………………………… 15 As I was walking home, I thought I was being followed ->…………………………………………………………………………… 16 Someone must have told Mai about the accident ... Change into passive form or active form They are interviewing the president on the TV at the moment ->…………………………………………………………………………… They deliver the post twice a day ->……………………………………………………………………………...
Ngày tải lên: 27/11/2013, 03:11
Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc
... (Beckman TLA 100.2; Beckman Coulter, 3168 Taipei, Taiwan) Then, the supernatant and pellet were analyzed by 10% SDS ⁄ PAGE and visualized by Coomassie Blue staining Hemolytic activity assay Human ... the same time an antidote We believe that the major reason why Volvariella volvacea produces VVA1 is so that it can associate with and, at the right ratio, enhance the toxicity of VVA2 As shown ... color, panels b and f) The overlay of both images is shown in panels c and g The phase-contrast image shows cellular morphology (phase panel) Bar, 40 lm via SDS ⁄ PAGE analysis (Fig 4A, lane 2)...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx
... dose and route of supplementation Data from a meta-analysis suggested that glutamine supplementation in critically ill patients may be associated with a decrease in complications and mortality rate, ... ratio obtained at h (data not shown) At 30 the basolateral ⁄ apical uptake ratio was 9.1 ± 3.7 and 5.2 ± 0.3 for 5-dayand 15-day-differentiated cells, respectively At 24 h the basolateral ⁄ apical ... h of labelling, apical (C) and basolateral (D) neonatal and postweaning pigs [60] The fact that this enzyme has a quite high turnover in the Caco-2 cells may indicate that a substantial amount...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: Plant a-amylase inhibitors and their interaction with insect a-amylases ppt
... insect-resistant transgenic plants In some cases, the a- amylase inhibitors act only against mammalian a- amylases or, on the contrary, just against insect a- amylases In the latter case, this provides a highly ... PPA and HSA None WRP26 T aestivum None WRP27 T aestivum None 1,2 and BIII S cereale S cereale HSA HSA and PPA AAI A hypochondriacus None activity CAI PAI Zeamatin V.unguiculata C cajan Z mays ... Secale cereale [47,52] and rice Oryza sativa [53] but also in leguminosae such as pigeonpea Cajanus cajan [54], cowpea Vigna unguiculata [55] and bean P vulgaris [56,57] These inhibitors have...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx
... the transmembrane region of APP, and has the typical amino acid composition of transmembrane helices, i.e small (Gly and Ala) and hydrophobic (Ile, Leu, Met and Val) residues [36] The only charged ... with the routine CALIBA of the program package DYANA [29] After discarding redundant and duplicated constraints, the final list included 130 intraresidue and 283 interresidue (149 sequential and ... concentration and temperature conditions Several organic solvents and mixtures of organic solvents with water, such as trifluoroethanol, trifluoroethanol/H2O, hexafluoroacetone hydrate, hexafluoroacetone...
Ngày tải lên: 08/03/2014, 09:20
Detection of an uncharged steroid with a silicon nanowire field effect transistor
... novel nano-bio-device can attain a femtomolar level Acknowledgements National Science Council and the MOE-ATU Program in Taiwan provided financial support References [1] B.G England, G.H Parsons, ... 19-NA at various concentrations, the conductance of Art KSI/mA51-labeled SiNW-FET rapidly increased to a constant value [Fig 5(b)] 19-NA at a greater concentration resulted in a greater conductance, ... Chang et al / Sensors and Actuators B 138 (2009) 148–153 149 with HF solution After defining the contact pad patterns, a stack of Ti (10 nm) and Au (100 nm) was then evaporated with a thermal...
Ngày tải lên: 16/03/2014, 15:23
Báo cáo khoa học: The chloroplast ClpP complex in Chlamydomonas reinhardtii contains an unusual high molecular mass subunit with a large apical domain doc
... in green algae and vascular plants, i.e the green lineage of plants ClpP genes are also found in Cyanobacteria [22] and in the genome of the Cyanophora cyanelle, an ancestral chloroplast In the ... ClpP1 antibody The ClpP1H and ClpP1L bands decrease slowly and concomitantly after 24 h, indicating that both are stable in the cell As a loading control, a duplicate blot was reacted with an antibody ... Institute and the Chlamydomonas Genome Project for EST data and ´ cDNA material, and H Moreau (Observatoire Oceanologique de Banyuls, France) for granting us access to the Ostreococcus blast analysis...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo Y học: Domain V of m-calpain shows the potential to form an oblique-orientated a-helix, which may modulate the enzyme’s activity via interactions with anionic lipid potx
... Gaussian and Lorentzian bandshapes Best fits were obtained by assuming a Gauss fraction of 0.55–0.6 The CURFIT procedure measures the peak areas of single band components and, after statistical evaluation, ... analysed, and, for those with strong absorption bands, the band parameters (peak position, band width, and intensity) were evaluated with the original spectra, if necessary after the subtraction ... proximal in the area delineating candidate oblique-orientated a- helix-forming segments, indicating that m-calpain domain V may contain an oblique-orientated a- helix comparable to that of HA2 Consistent...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: Crystal structure of RNase A tandem enzymes and their interaction with the cytosolic ribonuclease inhibitor potx
... SGRSGRSGRATE and RI was studied with a Beckman Optima XL -A analytical ultracentrifuge (Palo Alto, CA, USA), using an An-50Ti rotor The experiment was carried out at 40 000 r.p.m (130 000 r.p.m.) and ... relative to monomeric RNase A, with RNA as substrate; 1–5%, relative to monomeric RNase A, with 6-carboxyfluorescein-dArU(dA)2-6-carboxytetramethylrhodamine (FAM-AUAA-TAMRA) as substrate] and ... structure was assessed with procheck [38] (Ramachandran plot statistics: $88% of all amino acids in favored regions, and $12% in allowed regions) Analytical ultracentrifugation For analysis of...
Ngày tải lên: 22/03/2014, 16:21
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... for 20 h mRNA was quantitated by northern analysis with radiolabelled probes followed by radioluminography RNA blots were successively analyzed with a transporter probe and with a GAPDH probe ... graded transactivation potential Nucleic Acids Res 25, 2723–2729 13 Akagi K, Kanai M, Saya H, Kozu T & Berns A (2001) A novel tetracycline-dependent transactivator with E2F4 transcriptional activation ... Fig 2) Relative background transcription was calculated from the ratios of signals for transporter mRNA and GAPDH mRNA With OCT1, OCT2, and CAT4 both vectors were analyzed alongside on a single...
Ngày tải lên: 23/03/2014, 09:21
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
... GACCTGGCCACTGTGGAATTCTGTGATGCACAG; mCtBP2 .A5 8E.R, CTGTGCATCACAGAATTCCACAGT GGCCAGGTC; mCtBP2.V72R.F, GAAATCCATGAGA AGCGGTTGAATGAAGCTGTG; and mCtBP2.V72R.R, CACAGCTTCATTCAACCGCTTCTCATGGATTTC) BglII- and SalI-digested mutant ... the indicated monoclonal antibodies (anti-CtBP1, upper panel; and anti-FLAG M2, lower panel) Five per cent of each total cell extract (input) was similarly analysed with CtBP1 and FLAG M2 antibodies ... generated by PCR as described above with the same sense oligonucleotide and an antisense oligonucleotide containing an SstI site 5¢-AT GCACACACGTAAGGCACTCAGCTGAGATCTCGAG3¢ The BamHI–KpnI and BamHI–SstI...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: Contribution of a central proline in model amphipathic a-helical peptides to self-association, interaction with phospholipids, and antimicrobial mode of action ppt
... believed that many membrane-active antimicrobial peptides pass through the peptidoglycan layer and then kill the target micro-organism by interacting with and permeabilizing the cytoplasmic membrane ... Membrane-active peptides mediate a wide range of biological events, including signal transduction, transport through the membrane, membrane fusion and lysis, ion channel formation, and antimicrobial ... contained saturated a- cyano-4-hydroxycinnamic acid in 50% acetonitrile ⁄ 0.1% trifluoroacetic acid Determination of antimicrobial activity The antimicrobial activity of peptides against a range...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: No evidence for a role in signal-transduction of Na+/K+-ATPase interaction with putative endogenous ouabain potx
... Identification and characterization of a ouabain-like compound from human plasma Proc Natl Acad Sci USA 88, 6259–6263 Hansen, O (1989) Characterization of fatty acid interaction with ouabain and vanadate ... another group in collaboration with Hamlyn [21] by means of two independent assays, a radioimmunoassay using an anti-ouabain Ig and an enzymatic assay using ouabain-sensitive Na+/K+ATPase from ... on rat wild-type, as well as mutant Na+/K+-ATPase, have been carried out with mammalian cell lines transfected with cDNA constructs encoding a ouabain-resistant a1 -isoform or derived ouabain-resistant...
Ngày tải lên: 23/03/2014, 17:21
Báo cáo khoa học: Identification of critical residues of subunit H in its interaction with subunit E of the A-ATP synthase from Methanocaldococcus jannaschii potx
... primers 5¢-GTTGCCA TGGCTGTGAAATTGATGGGA-3¢ (forward), 5¢-CTCCG AGCTCTCATGGCAGTTTAAC-3¢ (reverse) and 5¢-ATA CCATGGAACAGCCAGAGTATAAAG-3¢ (forward), 5¢AGGGAGCTCTCAGAATAACTTCTCTGTA-3¢ (reverse), respectively, ... Acknowledgements We thank Dr Subramanian Vivekanandan for his support in the analysis of NMR data and critical reading of the manuscript We are grateful to Dr C F Liu for synthesizing the peptides and Dr S ... (using 2500 V voltage, 25 lF capacitance and 200 W resistance), and transformants were selected on Luria–Bertoni (LB) agar plates containing 30 lgÆmL)1 kanamycin and 12.5 lgÆmL)1 tetracyclin The cloned...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: Solution structure of an M-1 conotoxin with a novel disulfide linkage pdf
... resonance of 4,4-dimethyl-4-silapentane-1-sulfonic acid used as an internal standard Distance restraints and structure calculations An initial survey of distance constraints was performed on a series ... zation of a novel conus peptide with apparent antinociceptive activity J Biol Chem 275, 32391–32397 18 Sharpe IA, Gehrmann J, Loughnan ML, Thomas L, Adams DA, Atkins A, Palant E, Craik DJ, Adams DJ, ... outcome was a set of 20 ˚ structures with a mean global rmsd of 0.56 ± 0.16 A and a ˚ mean global heavy atom rmsd of 1.30 ± 0.28 A Structural refinement was carried out using amber and structure quality...
Ngày tải lên: 30/03/2014, 09:20