1 3 is it a reasonable layout

Tài liệu The Decline in the U.S. Personal Saving Rate: Is It Real and Is It a Puzzle? pptx

Ngày tải lên : 16/02/2014, 11:20

... Saving and Total Realized Capital Gains (annual) $ Billions 650 Total Realized Capital Gains 550 NIPA Personal Saving 450 35 0 250 15 0 50 –50 19 54 19 57 19 60 19 63 19 66 19 69 19 72 19 75 19 78 19 81 1984 ... ρt +1 = rt +1, that is, all capital gains are realized—never disappears as long as rt +1 ≠ Formally, this means that while the NIPA personal saving rate is measured to be stNIPA = +1 (1 − τ ) Lt +1 ... Personal Saving as a Percent of Disposable Personal Income (eight-quarter moving average, quarterly, SA) Percent 18 Flow of Funds 16 NIPA 14 12 10 19 54 19 57 19 60 19 63 19 66 19 69 19 72 19 75 19 78 19 81...

24
500
0

Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

Ngày tải lên : 18/02/2014, 06:20

... niacin-related FEBS Journal 276 (2009) 6 615 –66 23 ª 2009 The Authors Journal compilation ª 2009 FEBS 66 21 Crystal structure of human ACMSD 10 11 12 13 14 15 16 17 18 19 20 S Garavaglia et al compounds ... nonoxidative decarboxylation catalysed by a- amino-b-carboxymuconate-e-semialdehyde decarboxylase J Am Chem Soc 12 9, 9278–9279 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H ... 277, 3 516 2 3 516 7 Tanabe A, Egashira Y, Fukuoka SI, Shibata K & Sanada H (2002) Expression of rat hepatic 2-amino3-carboxymuconate-6-semialdehyde decarboxylase is affected by a high protein diet and...

9
796
0

Báo cáo khoa học: Fowlicidin-3 is an a-helical cationic host defense peptide with potent antibacterial and lipopolysaccharideneutralizing activities ppt

Ngày tải lên : 07/03/2014, 11:20

... 13 8 83) , and Gram-positive bacteria (Listeria monocytogenes ATCC 19 115 , Staph aureus ATCC 259 23, Staph aureus ATCC BAA -39 , and Staph aureus ATCC 433 00) were purchased from either ATCC (Manassas, VA, ... as recommended by the Clinical and Laboratory Standards Institute [15 ] using ATCC No Fowl -3 (lM) Fowl -1 (lM) 25922 14 028 13 076 13 8 83 700408 2 2 2 2 19 115 259 23 433 00 BAA -39 1 2 fowlicidin -1 as ... presence and absence of 10 0 mM NaCl at 37 °C A chromogenic substrate for b-galactosidase, o-nitrophenyl-b-D-galactopyranoside, was also added to a ﬁnal concentration of 1. 5 mM The absorbance at 405...

11
496
0

My idea: is it a business? pptx

Ngày tải lên : 29/03/2014, 18:20

... business Attracting partners Govenment support Checklist Case study (FireAngel®) Case study (Solio) 3 6 10 11 12 13 14 15 16 17 18 Research Researching your idea is vital Be realistic about the ... Property Office is an operating name of the Patent Office A DTI SERVICE Phone: 016 33 811 010 Fax: 016 33 811 020 E-mail: sas@ipo.gov.uk All Publications are available through the UK Intellectual Property ... 250 Fax: 016 33 817 777 This leaflet provides basic information on some areas of trade marks It is not a reference book and has no legal authority www.ipo.gov.uk For copies in alternative formats...

24
315
0

Báo cáo khoa học: "SemiWhole brain radiotherapy with a conformational external beam radiation boost for lung cancer patients with 1-3 brain metastasis: a multi institutional study" pdf

Ngày tải lên : 09/08/2014, 08:22

... epidemiology 19 96, 49 : 13 73 - 13 79 doi :10 .11 86 /17 48- 717 X-5 - 13 Cite this article as: Casanova et al.: Whole brain radiotherapy with a conformational external beam radiation boost for lung cancer patients with ... Page of 15 Egawa S, Tukiyama I, Akine Y, Kajiura Y, Yanagawa S, Watai K, Nomura K: Radiotherapy of brain metastases International journal of radiation oncology, biology, physics 19 86, 12 :16 21- 1625 ... Extra cranial failure only was observed in 18 patients, and patients presented with extra cranial failure/local brain failure/distant brain failure and extra cranial failure/distant brain failure,...

8
374
0

Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx

Ngày tải lên : 09/08/2014, 10:23

... 5'-AAGGACAGGATCCACTTGACCTATAGTGAGTCGTATTA -3' 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA -3' siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA -3' ... 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA -3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA -3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA -3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA -3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA -3' ... 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA -3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA -3' siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA -3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA -3' T7 5'-TAATACGACTCACTATAG -3' ...

8
576
0

Bóa cáo y học: " Early apoptosis of blood monocytes in the septic host: is it a mechanism of protection in the event of septic shock" ppt

Ngày tải lên : 12/08/2014, 23:23

... (40.74) 16 (44.44) Pseudomonas aeruginosa (18 . 51) (25.92) (11 .11 ) Others (7. 41) (11 .11 ) (5.55) Bacteraemia [n (%)] (14 . 81) (11 .11 ) ( 13 .88) Case fatality [n (%)] (22.2) (33 .3) 18 (50.0) Number of patients ... Diabetes mellitus type (14 . 81) (14 . 81) (16 .66) Coronary heart disease (11 .11 ) (29.62) (11 .11 ) Hypertension (7. 41) (22.22) (11 .11 ) Others (22.22) - (22.22) Acinetobacter baumannii 10 (37 . 03) 11 ... 12 .44 ± 18 . 41 6 .12 ± 3. 20* 95.4 ± 24.2 12 3 .1 ± 61. 1 10 2.9 ± 20 .3 69.4 ± 26.4 212 .3 ± 30 .7 88 .3 ± 25 .3* 80 .1 ± 21. 2 63. 7 ± 27.7 96.6 ± 26 .1 114 .6 ± 31 . 8 14 1.2 ± 25.7 83. 2 ± 22 .1 89.4 ± 25.4 11 2.2...

8
350
0

Gamma glutamyltransferase is it a biomarker of oxidative stress

Ngày tải lên : 06/10/2015, 21:29

... samples showed that there was a greater proportionate increase in GGT than in aspartate transaminase (AST) or alanine aminotransferase (ALT) as shown in figure 1. 10 .3 .1 below 26 Figure 1. 10 .3 .1 ... between genders with age This result is consistent with other findings with confounding factors of gender 1 13 -11 6 and age 112 , factors such as pregnancy1 21, 12 2 11 7 -12 0 There are a series of other ... childbirth1 23, race 115 , smoking 115 , the use of oral contraceptives 112 , 11 5 and exercise124, which affect the levels of serum GGT 23 Figure 1. 10 .1 shows the mean of serum GGT activity with different age...

110
396
0

Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inﬂammation pptx

Ngày tải lên : 07/03/2014, 02:20

... ATCTTCCAGgtaacaac 625 cacctcagGGTCACGCC 1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 8 51 CTTCTCCCGgtgtgcac 4 03 gtccccagGCCGGATCA 64 AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 17 2 CAACAAAGgtacatgc 13 35 ... ligating full-length SAF -3 or SAF -1 cDNA into the pCDNA3 .1- His vector (Invitrogen, Carlsbad, CA, USA) The ()2000/+200)SAF-CAT, ()2000/ )3 51) SAF-CAT and ( )3 51/ +200)SAF-CAT plasmids were prepared ... contains a TATA-less promoter that responds to MAZ and Sp1 J Biol Chem 2 71, 4 417 –4 430 12 Ray A, Schatten H & Ray BK (19 99) Activation of Sp1 and its functional co-operation with serum amyloid A- activating...

11
439
0

Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modiﬁed conotoxin, reveals that the glycan structure is a-D-Gal-(1ﬁ3)-a-D-GalNAc pot

Ngày tải lên : 23/03/2014, 13:20

... (1H) GalNAc:H1 GalNAc:H3 GalNAc:H3 Gal:H1 Gal:H1 Gal:H2 GalNAc:CH3 GalNAc:CH3 GalNAc:CH3 4.79 3. 77 3. 77 4.82 4.82 3. 53 1. 79 1. 79 1. 79 GalNAc:H2 GalNAc:H2 Gal:H1 Gal:H2 Gal:H3 Gal:H4 Gal:H2 Gal:H3 ... Gal:H3 Gal:H4 3. 95 3. 95 4.82 3. 53 3. 43 3.72 3. 53 3. 43 3.72 Proton (1H) Chemical shift (p.p.m.) Proton (1H) Chemical shift (p.p.m.) GalNAc:H1 GalNAc:CH3 GalNAc:H3 GalNAc:H1 Gal:H2 Gal:H2 4.79 1. 79 ... 1. 79 3. 77 4.79 3. 53 3. 53 10 ThrcCH3 12 AlaaH 10 ThrcCH3 10 ThrbH 11 AlaßCH3 12 AlaaH 0.98 4.07 0.98 4.04 1. 09 4.07 anomeric proton of Gal, which identiﬁed that the Gal residue is linked to the GalNAc...

11
563
0

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

Ngày tải lên : 24/03/2014, 04:21

... previously [11 ] To replace Ser274 in ik3 -1 cDNA with Thr or Ala, mutagenic primers, 50 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA -30 or 50 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA -30 (corresponding ... ik3 -1 and cdk3 A kinase assay with p35cdk3 immunoprecipitated from COS7 cells indicated that p70ik3 -1 did not activate the cdk3-mediated phosphorylation of pRb, histone H1, or the C-terminal ... vitro (Fig 4) The same residue is also phosphorylated by both cdk3/cyclin A and cdk3/E in vivo (Fig 5) Analysis of ik3 -1 amino-acid sequence indicates that ik3 -1 has a putative ZRXL (Z and X are...

7
308
0

Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

Ngày tải lên : 20/06/2014, 23:20

... coli alcohol dehydrogenase Vaidyanathan et al AMB Express 2 011 , 1: 37 http://www.amb-express.com/content /1/ 1 /37 Page of Table Bacterial strains and plasmid vectors used in this work Strain or plasmid ... Klebsiella pneumoniae for bioconversion of glycerol into 1, 3- propanediol Appl Microbiol Biotechnol 87: 217 7– 218 4 doi :10 .10 07/s002 53- 010 -2678-0 doi :10 .11 86/ 219 1-0855 -1- 37 Cite this article as: Vaidyanathan ... antimicrobial activities targeting diverse enteric bacterial pathogens Anaerobe 14 :16 6 17 1 doi :10 .10 16/j.anaerobe.2008.02.0 01 Talarico TL, Axelsson LT, Novotny J, Fiuzat M, Dobrogosz WJ (19 90) Utilization...

8
399
0

Unit 3 - What is it? Cái gì đây?-phần 1 pptx

Ngày tải lên : 12/07/2014, 03:20

... /fɔːk/ n d a glass /glɑːs/ n ly handbag /ˈhænd.bæg/ n túi xách tay (nữ) house n nhà ice-cream /a sˈkriːm/ n kem, cà rem key /kiː/ n ch a khoá knife /naɪf/ n dao lemon /ˈlem.ən/ n chanh lorry /ˈlɒr.i/ ... /haʊs/ orange /ˈɒr.ɪndʒ/ n cam pen /pen/ n viết mực plate /pleɪt/ n đ a radio /ˈreɪ.di.əʊ/ n máy thu shelf /ʃelf/ n kệ spoon /spuːn/ n muỗng table /ˈteɪ.bļ/ n bàn taxi /ˈtæk.si/ n xe taxi that ... đây, this /ðɪs/ pron đây, those /ðəʊz/ pron đó, towel /taʊəl/ n khăn tắm train /treɪn/ n xe l a umbrella /ʌmˈbrel.ə/ n dù watch /wɒtʃ/ n đồng hồ đeo tay what /wɒt/ pron window /ˈwɪn.dəʊ/ n c a sổ...

6
439
0

Báo cáo khoa học: "Postmastectomy irradiation in breast in breast cancer patients with T1-2 and 1-3 positive axillary lymph nodes: Is there a role for radiation therapy" ppsx

Ngày tải lên : 09/08/2014, 09:20

... 1. 865 1. 21- 11. 8 1. 124 1. 717 0.44-6.65 0 .11 5 2 .12 0 0.68 -15 .35 0 .10 2 3. 4 71 1 .14 -10 .57 0.0 01 2 . 13 9 1. 28 -11 . 21 1. 239 2. 819 0. 91- 8.75 0 .11 0 2 .14 3 1. 22 -17 .95 0.087 1. 2 53 1. 18 -16 . 13 1. 124 4.7 43 1. 70-7.28 ... 0 .32 -2.80 0.922 0.966 0 .33 -2.87 0.9 51 1 .10 8 0 .36 -3. 39 1. 000 1. 037 0 .30 -3. 62 0.859 3. 955 0.78 -11 .3 0.022 3. 052 0.98-9.87 0.0 21 1.6 31 0.46-5.82 0.547 1. 7 71 0.56-5.60 0.409 3. 3 23 1. 34 -12 .1 0. 0 13 1. 865 ... medullary) 10 15 17 I 10 15 33 II III 39 17 59 26 11 41 26 I 14 22 33 II 26 39 11 46 III 26 39 21 Lymphatic 47 71 11 46 Vascular Perineural 42 34 64 52 13 54 21 Estrogen receptor 49 74 17 71 Progesteron...

8
357
0

Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx

Ngày tải lên : 13/08/2014, 01:21

... Nuclear matrins: identification of the major nuclear matrix proteins Proc Natl Acad Sci USA 19 91, 88 :10 31 2 -10 31 6 51 Hisada-Ishii S, Ebihara M, Kobayashi N, Kitagawa Y: Bipartite nuclear localization ... M, Asano S, Nakamura T, Adachi M, Yoshida M, Yanagida M, Nishida E: CRM1 is responsible for intracellular transport mediated by the nuclear export signal Nature 19 97, 39 0 :30 8- 31 1 38 Askjaer P, ... B p37 IP: anti-HA WB: antiGFP stop ATG p37 Gag CDS p37 RRE p37 Gag CDS RRE p37 p37 Gag CDS GFP-Rev CTE p37 M1 -10 Input HA-Matrin3 WB: anti-HA p37 Gag CDS codon optimized p37 M1 -10 RRE p37 Gag...

10
313
0

NGHIÊN CỨU ẢNH HƯỞNG CỦA PHÂN BÓN NPK (3-6-1) ĐẾN SINH TRƯỞNG CỦA LÁT HOA (Chukrasia tabularis A.Juss) GIAI ĐOẠN 1 - 3 THÁNG TUỔI TẠI VƯỜN ƯƠM CƠ SỞ 3 TRƯỜNG ĐẠI HỌC HỒNG ĐỨC

Ngày tải lên : 31/10/2012, 10:20

... 40.75 37 .75 37 .75 37 .75 37 .75 χ n tính toán 0.0 217 39 2. 630 435 4.8 9 13 04 15 .847 83 2.0996 93 0.07 515 3 5 .33 8957 1. 289877 2.02 814 6 1. 39 238 4 13 .11 424 11 .405 63 60 . 13 538 χ2n tra bảng 12 .6 Qua bảng (3 .15 ) ... 06-07/05/2 011 H D L 49 17 3, 662 1, 27 2,459 31 51 7,45 1, 78 7,08 29 40 11 49 12 3, 5 83 1, 32 6 2,7 93 45 41 8,74 2,02 8,45 45 39 46 3, 76 1, 37 3 ,10 6 60 25 9,72 2, 23 9,86 60 26 52 20 3, 049 1, 512 1, 8 63 11 53 ... Groups Within Groups Total Count 3 3 SS 0.7 038 0.049 0.7528 Sum Average 5 .33 1. 77667 6.06 2.02 6.7 2. 233 33 4.78 1. 5 933 3 df Variance 0.006 03 0.0027 0. 010 03 0.005 73 MS 11 F 0. 234 63 0.00 612 38 .30 7 03 P-value...

56
2K
5

E7 Unit 7 A 1,3

Ngày tải lên : 26/09/2013, 03:10

... start at 7.00 F 7 .15 7 .15 11 .30 3. Her classes finish at 11 .30 F 3. Her classes finish at 11 .15 4.Her summer vacation F / start in July June July 5.She will visit her parents in T summer vacation ... Warm - up 1. What time your classes start ? What time they finish ? Unit The world of work Lesson1 A A student/s work (1, 3) I.True/ false statements 1. Hoa s breakfast is at 6 .30 T 2.Her classes ... II.Answer the questions / / What how Hoasdo Hoa they classes 3. For time many hours a What will 2.What time 1. What time Hoa s start ? her vacation ? day doesstart ? her during classes? Hoa finish...

8
428
0

EL 6 U6 Lesson A 1-3

Ngày tải lên : 25/10/2013, 23:11

... What’s this? What’s that? It s a river It s a river What are these? They’re trees What are those? They’re trees What’s this/that? It s a lake What are these/those? They’re flowers What’s this/that? ... this/that? It s a park * Complete the sentences: yard a/ Our house has a ……… hotel b/ There is a ………… It is near arice paddy ……………… lake near the …… river c/ There is a ………… and a …………… park trees ... PLACES Listen and read: Hello.My name’s Thuy I’m twelve and I’m a student I have a brother,Minh He’s twenty We live in a house near a lake.Our house has a yard It s beautiful here.There is a...

21
268
0

E 7(Unit 8( A 1-3)

Ngày tải lên : 01/11/2013, 05:11

... They are waiting for a train UNIT OUT AND ABOUT Period 48: A1 , 2, - What is he doing ? - He is playing computer games - What are they doing ? - They are waiting for a train UNIT OUT AND ABOUT ... 48: A1 , 2, I Vocabulary (to) play video games UNIT OUT AND ABOUT Period 48 A1 , 2, I Vocabulary (to) ride - bike UNIT OUT AND ABOUT Period 48: A1 , 2, I Vocabulary (to) wait for UNIT OUT AND ABOUT ... I am driving my car We are waiting for a train UNIT OUT AND ABOUT Period 48: A1 , 2, Để nói người khác làm gì: Form: Example: I am playing video games UNIT OUT AND ABOUT Period 48: A1 , 2, Hoa...

29
403
0

Tài liệu Unit 1- What is a computer? pptx

Ngày tải lên : 21/12/2013, 20:15

... as in the example below Computers accept information, perform mathematical and/or logical operations then supply new information All computers have three basic capabilities A computer is a machine ... tells it (10 ) what to and gives it the appropriate information; but because electric pulses can move at the speed of light, a computer can carry out vast numbers of arithmetic-logical operations almost ... time it takes a human being to the job A computer can replace people in dull, routine tasks, but it( 9) has no originality; it works according to the instructions given to it and cannot exercise any...

4
862
3