1—retrieve the metadata of a single object

... 32 Lan L, Nakajima S, Oohata Y, Takao M, Okano S, Masutani M, Wilson SH & Yasui A (2004) In situ analysis of repair processes for oxidative DNA damage in mammalian cells Proc Natl Acad Sci USA ... critical reading of the manuscript and for communicating his data before publication 5761 Mammalian DNA single- strand break repair J L Parsons et al References Caldecott KW (2001) Mammalian DNA single- strand ... A B Mammalian DNA single- strand break repair this period Approximately 80% of the repair of the substrate is achieved within at a point where the proteins are dissociating from the DNA Therefore,...

Ngày tải lên: 23/03/2014, 11:20

... adsorbed by H The charge around the H atom at the Si adatom removes toward the adsorbed Ag atom and forms a covalent-like Ag-H bond Due to the charge transfer from the H to the Si adatom on the ... calculating the total energy of the system including full relaxation of all Si atoms and H atoms (except for the bottom hydrogenated Si atoms) and the Ag adatom The adsorption energies (Ead) are ... influences of H on the Ag adsorption at a Si(111)-7 surface, we first calculate the adsorption energies of Ag atom at the high coordination sites on the clear and 19H-Si(111)-7 surfaces, because all the...

Ngày tải lên: 22/06/2014, 00:20

... substrate S-2444 and measurement of the increase in absorbance at 405 nm The specific inhibitory activity of PAI-1 was calculated from the amount of PAI-1 that had to be added to inhibit 50% of the ... Mab-1 The EC50 values for binding of each variant to Mab-1 or Mab-2 were determined in parallel with the EC50 value for wt and expressed as a fraction of that The means and standard deviations of ... inhibitory activity of any of the variants, and all variants had IC50 values for inactivation by XR5118 indistinguishable from that of wt (data not shown) Whereas wt PAI-1 was totally resistant to...

Ngày tải lên: 20/02/2014, 11:20

... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... not mark any as poor or inappropriate Another structural analysis, obtained by the VERIFY3D program [61], gave an average value of 0.21, which is greater than zero, the quality value indicated ... and therefore a positive value indicates better than average and their maximum values are around The values for all these parameters obtained for the PsbQ model were quite good and the programs...

Ngày tải lên: 21/02/2014, 00:20

... shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... translocation to the nucleus Although functional analyses of individual domains have not been addressed, the global context of the domain analyses allows us to draw a more general picture of the ... DIDO-related apoptosis occurs as a result of alterations in DNA regulation caused by chromatin instability Computational analyses Although all splice variants share common domains, long regions of the...

Ngày tải lên: 07/03/2014, 21:20

... GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA ... GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT Immunoglobulin domain (type ... physiological consequence Again, the ADAM10 transgenes remained without effect in all investigated mouse lines (Fig 5A) G-ratios of ADAM10mo as well as of ADAM10dn mice at postnatal day 17 were identical...

Ngày tải lên: 16/03/2014, 04:20

... Shore as a storage system Some of the advantages of Polar over most of the mentioned systems are itemized as follows • Use of a standard data model: Polar adopts a standard object data model, the ... Muralikrishna M Gamma a high performance dataflow database machine Proceedings of the International Conference on Very Large Data Bases, Kyoto, Japan, August 1986 Morgan Kaufmann: San Mateo, CA, ... XML data using object database systems (e.g [46]), despite the fact that XML data have a tree-like structure that can be naturally mapped into linked objects of a object database Nowadays object...

Ngày tải lên: 17/03/2014, 00:20

Ngày tải lên: 21/03/2014, 22:01

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

... (Iwatani, Fukuoka, Japan) All other chemicals used were of analytical grade Formation of a- hydroxyhaem-rHO-1 complex Scheme The resonance structure of a- hydroxyhaem Unless otherwise stated, the ... disappeared, indicates the formation and degradation of a trace amount of the CO-ferrous verdohaem produced from the free a- hydroxyhaem Acidification and extraction of the product into chloroform gave biliverdin, ... Matera et al [26]; the optical spectrum of the ferric form exhibited a rather broad Soret band, whereas the Soret bands of the ferrous and ferrous-CO forms were narrow (Fig 1B) The ratios of the...

Ngày tải lên: 23/03/2014, 21:20

... camp fire at a great pow-wow in the wigwam of the excellent Savages, alas! remain The old Grecian Theatre in the City Road was the nursery of many members of the theatrical profession, and authors ... with anxiety as to the fluctuations of the Bank rate Be that as it may, I cannot refrain from citing here the case of another brother artist, who was particular in the extreme as regarded the neatness ... to a quick eye and a ready pencil." I can appreciate the fact that at that early age I had an eye for the "pathetic, and even beautiful," but, alas! I have been misunderstood from the day of...

Ngày tải lên: 29/03/2014, 22:20

... relative to the native strain, during the second half of the logarithmic phase (Figure 5) The batch experiment has revealed that 1, 3-PD, acetate and ethanol are growth-associated in both the native ... rate of the recombinant culture (Jarboe et al 2010; Zhu et al 2009) The decreased μmax of the recombinant strain could also be attributed to the metabolic load imposed by the recombinant plasmid ... http://www.amb-express.com/content/1/1/37 a Page of b Figure Time course of metabolite formation by recombinant (open circles) and native strain (triangles) strains of L reuteri in batch cultivation a lactate (• ― •), acetate (―) and...

Ngày tải lên: 20/06/2014, 23:20

... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum confinement ... decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated temperature did not ... [30] a kðhv À EgÞn=2 hv ð1Þ In Eq 1, k and n are constants and Eg is the band gap energy of the bulk semiconductor The n value is for indirect-gap materials Values of the optical band gap for the...

Ngày tải lên: 22/06/2014, 22:20

... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum confinement ... decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated temperature did not ... [30] a kðhv À EgÞn=2 hv ð1Þ In Eq 1, k and n are constants and Eg is the band gap energy of the bulk semiconductor The n value is for indirect-gap materials Values of the optical band gap for the...

Ngày tải lên: 22/06/2014, 22:20

... paragraphs that we can always find the rational part of the integral, and can find the complete integral if we can find the roots of Q(x) = The question is naturally suggested as to the maximum of ... constants which are the roots of an algebraical equation are treated as known then the form of the integral can always be determined completely But as the roots of such equations are not in general ... sum of an algebraical function and of a finite number of constant multiples of logarithms of algebraical functions All algebraical functions which occur in the integral are rational functions of...

Ngày tải lên: 28/06/2014, 19:20

... "Thanh Hoa" hay "Nguyen Thanh Hoa" Điều cấm kị nên bạn thật lưu tâm THE SUPERSCRIPTION (PHẦN Đ A CHỈ TRÊN B A THƯ) Các bạn lưu ý gửi thư cho người phụ nữ phải viết phần tên hiệu phần đ a b a thư ... Bởi chữ ký phần quan trọng mang tính biểu trưng thay cho bạn nên cần phải thống thư từ hay văn giấy tờ Ví dụ, tên Nguyen Thanh Hoa bạn không nên gửi thư cho người ký tên "Hoa" sau thư gửi đến người ... thư thân mật không trang trọng thường dùng: Yours sincerely, Yours very sincerely, Yours cordially, Yours faithfully, Yours gratefully, Yours affectionately, Very affectionately yours, Yours lovingly,...

Ngày tải lên: 12/07/2014, 01:20

... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi đến công ty "The...

Ngày tải lên: 12/07/2014, 01:20

... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi đến công ty "The...

Ngày tải lên: 12/07/2014, 01:20