1  changing the format of a list

Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

... by the American Foundation for AIDS Research (amfAR) Grant 02882-32-RGV, National Institutes of Health Grant AI054183 to R.M.R, National Institutes of Health Grant AI078779 to F.R.F and National ... Directed antigen delivery as a vaccine strategy for an intracellular bacterial pathogen Proc Natl Acad Sci USA 2006, 103:5102-5107 10 Roberts DM, Nanda A, Havenga MJ, Abbink P, Lynch DM, Ewald BA, ... in parentheses for each group All Lmdd-gag vaccinations were preceded by oral administration of saturated sodium bicarbonate D-ala (640 mg/kg) was co-administered intravenously before and after...

Ngày tải lên: 11/08/2014, 08:21

7 394 0
List the components of a radio system

List the components of a radio system

... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...

Ngày tải lên: 13/09/2012, 10:52

30 922 0
A study of the issues of teaching listening setions in tiếng anh 11 at high schools in nghe an

A study of the issues of teaching listening setions in tiếng anh 11 at high schools in nghe an

... Teachers .53 4.2.1.6 Adaptation of the Textbook 55 a Frequency of Teachers Adaptation of the Listening Tasks 55 b Purposes of Teachers Adaptation 56 c Teachers Adaptation of ... variables, and that potentially any characteristic of the speaker, the situation or the listener can affect the comprehension of the message In short, it can be said that listening is a language skill ... rules of the second language in the first language That means when the second language is used, the emphasis of any listening is on translation of lexical items or grammar structures Grammar method:...

Ngày tải lên: 14/12/2013, 00:41

140 839 5
Tài liệu HOW INTERNET PROTOCOL-ENABLED SERVICES ARE CHANGING THE FACE OF COMMUNICATIONS: A LOOK AT VIDEO AND DATA SERVICES ppt

Tài liệu HOW INTERNET PROTOCOL-ENABLED SERVICES ARE CHANGING THE FACE OF COMMUNICATIONS: A LOOK AT VIDEO AND DATA SERVICES ppt

... be able to easily communicate changes in their signal area They need to easily change and verify their coverage information so that off-air and web broadcasts are ALWAYS identical BENEFITS OF AIR-TO-WEB ... over -the- air broadcasts to American families, and because of the value of localism in broadcasting Localism, a principle underlying the broadcast service since the Radio Act of 1927, serves the ... ensure that the underlying signal area data is always accurate The benefits to the consumers and the broadcasters are many Local broadcasters will be able to bring their programming to the Internet,...

Ngày tải lên: 18/02/2014, 00:20

99 515 0
Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx

Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx

... substrate S-2444 and measurement of the increase in absorbance at 405 nm The specific inhibitory activity of PAI-1 was calculated from the amount of PAI-1 that had to be added to inhibit 50% of the ... Mab-1 The EC50 values for binding of each variant to Mab-1 or Mab-2 were determined in parallel with the EC50 value for wt and expressed as a fraction of that The means and standard deviations of ... inhibitory activity of any of the variants, and all variants had IC50 values for inactivation by XR5118 indistinguishable from that of wt (data not shown) Whereas wt PAI-1 was totally resistant to...

Ngày tải lên: 20/02/2014, 11:20

8 547 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

... shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... translocation to the nucleus Although functional analyses of individual domains have not been addressed, the global context of the domain analyses allows us to draw a more general picture of the ... DIDO-related apoptosis occurs as a result of alterations in DNA regulation caused by chromatin instability Computational analyses Although all splice variants share common domains, long regions of the...

Ngày tải lên: 07/03/2014, 21:20

7 658 0
Ocean Acidification: A National Strategy to Meet the Challenges of a Changing Ocean docx

Ocean Acidification: A National Strategy to Meet the Challenges of a Changing Ocean docx

... existing data management offices and databases that could support ocean acidification observational and research data The FOARAM Act also calls for an “Ocean Acidification Information Exchange” that ... delineates ambitious priorities and goals for the National Ocean Acidification Program The FOARAM Act calls for the development of a detailed, 10-year strategic plan for the National Ocean Acidification ... contributions of calcite and aragonite, and hence of the organisms 23 Copyright © National Academy of Sciences All rights reserved Ocean Acidification: A National Strategy to Meet the Challenges of a Changing...

Ngày tải lên: 15/03/2014, 15:20

163 401 0
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

... GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA ... GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT Immunoglobulin domain (type ... physiological consequence Again, the ADAM10 transgenes remained without effect in all investigated mouse lines (Fig 5A) G-ratios of ADAM10mo as well as of ADAM10dn mice at postnatal day 17 were identical...

Ngày tải lên: 16/03/2014, 04:20

13 488 0
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf

Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf

... (Iwatani, Fukuoka, Japan) All other chemicals used were of analytical grade Formation of a- hydroxyhaem-rHO-1 complex Scheme The resonance structure of a- hydroxyhaem Unless otherwise stated, the ... disappeared, indicates the formation and degradation of a trace amount of the CO-ferrous verdohaem produced from the free a- hydroxyhaem Acidification and extraction of the product into chloroform gave biliverdin, ... Matera et al [26]; the optical spectrum of the ferric form exhibited a rather broad Soret band, whereas the Soret bands of the ferrous and ferrous-CO forms were narrow (Fig 1B) The ratios of the...

Ngày tải lên: 23/03/2014, 21:20

9 502 0
The Confessions of a Caricaturist, Vol. 1 ppt

The Confessions of a Caricaturist, Vol. 1 ppt

... smoked the calumet of peace round the camp fire at a great pow-wow in the wigwam of the excellent Savages, alas! remain The old Grecian Theatre in the City Road was the nursery of many members of the ... AS SPECIAL AT THE BALACLAVA CELEBRATION.] Naturally for this reason I have always taken an interest in the doings of that time; so it was quite amore that I acted as "special" at the first Balaclava ... Sullivan, who was a Nationalist, and a man of exceptional energy and ability, began life as an artist He came to Dublin, I was told, as a very young man, and began to paint; but the sails of his...

Ngày tải lên: 29/03/2014, 22:20

145 331 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

... relative to the native strain, during the second half of the logarithmic phase (Figure 5) The batch experiment has revealed that 1, 3-PD, acetate and ethanol are growth-associated in both the native ... http://www.amb-express.com/content/1/1/37 a Page of b Figure Time course of metabolite formation by recombinant (open circles) and native strain (triangles) strains of L reuteri in batch cultivation a lactate (• ― •), acetate (―) and ... rate of the recombinant culture (Jarboe et al 2010; Zhu et al 2009) The decreased μmax of the recombinant strain could also be attributed to the metabolic load imposed by the recombinant plasmid...

Ngày tải lên: 20/06/2014, 23:20

8 400 0
the study the reality of practicing listening skill of the third year major english students at dong thap university basing on the format of the ielts listening tests

the study the reality of practicing listening skill of the third year major english students at dong thap university basing on the format of the ielts listening tests

... are the speakers? A At a meeting B At a birthday party C At the airport D At the theatre Where are the speakers? A In a plane B On a roof C In an elevator D C The secretary‟s car D On a mountain ... too Nowadays books and magazines often are attached CD so that they can both listen to the CD and read the content of the books or magazines Those students can learn vocabularies through the pictures ... Marks Examiner1 Numbers I Examiner2 Code Word Listen to Sarah and Matthew talking about the people they met at a party What they say about each person? Listen and write a letter A- H next to each...

Ngày tải lên: 05/07/2014, 08:03

58 839 0
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần2 docx

Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần2 docx

... "Thanh Hoa" hay "Nguyen Thanh Hoa" Điều cấm kị nên bạn thật lưu tâm THE SUPERSCRIPTION (PHẦN Đ A CHỈ TRÊN B A THƯ) Các bạn lưu ý gửi thư cho người phụ nữ phải viết phần tên hiệu phần đ a b a thư ... Bởi chữ ký phần quan trọng mang tính biểu trưng thay cho bạn nên cần phải thống thư từ hay văn giấy tờ Ví dụ, tên Nguyen Thanh Hoa bạn không nên gửi thư cho người ký tên "Hoa" sau thư gửi đến người ... thư thân mật không trang trọng thường dùng: Yours sincerely, Yours very sincerely, Yours cordially, Yours faithfully, Yours gratefully, Yours affectionately, Very affectionately yours, Yours lovingly,...

Ngày tải lên: 12/07/2014, 01:20

13 597 2
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 docx

Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 docx

... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi đến công ty "The...

Ngày tải lên: 12/07/2014, 01:20

7 475 0
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 pdf

Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 pdf

... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi đến công ty "The...

Ngày tải lên: 12/07/2014, 01:20

7 575 1
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

... primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) ... M: Mammalian MAP kinase signalling cascades Nature 2001, 410:37-40 Palanki MS: Inhibitors of AP-1 and NF-kappa B mediated transcriptional activation: therapeutic potential in autoimmune diseases ... 7α-hydroxy-dehydroepiandrosterone (7α-OH-DHEA) is expressed as the percentage [3H]-7α-OH-DHEA of the total amount of [3H]label measured Results are expressed as the mean ± standard error of the mean of triplicate...

Ngày tải lên: 09/08/2014, 07:20

10 462 0
w