º that is a case of repeated inheritance

... recombinant factor VIIa and factor VIII therapy (a) The thrombus (arrow) was still attached to the tip of the removed endotracheal tube (b) The detached thrombus (arrow) was approximately 20 ... solid consistency, it occluded the tip of the endotracheal tube and the airways like a cork Recommendations on the use of recombinant activated factor VII as an adjunctive treatment for massive ... massive bleeding a European perspective Crit Care 2006, 10:R120 doi:10.1186/cc10041 Cite this article as: Lauer S, et al.: Recombinant factor VIIa and factor VIII treatment for acquired factor VIII...

Ngày tải lên: 14/08/2014, 07:21

... plasma as substrate (Hemoliance, Salt Lake City, UT) FXI antigen was measured by an ELISA based on a goat anti-human FXI afnity puried IgG as capture antibody and a goat antihuman FXI peroxidase-conjugated ... factor IX genes from haemophilia B families Br J Haematol 89, 409412 Maekawa H, Sugo T, Yamashita N, Kamiya K, Umeyama H, Miura N, Naka H, Nishimura T, Yoshioka A & Matsuda M (1993) Molecular ... Michaelis parameters of S-2366 hydrolysis by FXIa The Michaelis parameters, kcat and Km, were calculated on the basis of known concentration of wild-type and mutant FXIa and using the program grafit...

Ngày tải lên: 23/03/2014, 07:20

... TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ and 5¢-GTGAAAAACTGACTGAAAAACTGACTGAAAAAC TGACTGAAAAACTGA-3¢ were annealed to generate a dsDNA fragment, which we named T4-R¢¢ T4-R¢¢ was inserted into the PmaCI site of pRHC4 ... obtained by annealing oligonucleotides 5¢-GTTTTTCATG TTTTTCATGTTTTTCATGTTTTTCAC-3¢ and 5¢-GTG AAAAACATGAAAAACATGAAAAACATGAAAAAC-3¢, Synthetic oligonucleotides 5¢-TCAGTTTTTCAGTCAG TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ ... Designed DNA as an activator of transcription N Sumida et al transient transfection assay system, at a specific rotational phase and distance between T4 and the promoter [12] We concluded that T4 formed...

Ngày tải lên: 23/03/2014, 10:20

... 107), each rank being a hundred times greater than the last Gautama answers: ayuta, niyuta, karikara, vivara, achobya, vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that' s ... estimate wasn't all that bad This is a spectacular application of the Greek insight that the world afar can be grasped by analogy to the world at hand But it is made much more spectacular when ... the greatest advantage of this notation Whoever it was, in the latter days of Babylon, that first gave to airy nothing a local habitation and a name, has left none himself Perhaps that double wedge...

Ngày tải lên: 05/06/2014, 11:23

... WHAT IS CLAUSE?  A c laus e is a group of words that contains a subject and a finite verb Ex: I get slimmer and slimmer S  A c laus e V constitutes only part of a sentence Ex: ... clause is often called a relative clause because it relates back to a noun whose meaning it modifies - They are often introduced by special words called relative pronouns: who, whose, whom, that, ... noun, adjective, and adverb gfgghgnggggggggdis ghxhgxsjhajhabBDJ HSGDJHGDJHSDJH VXHDVHSVDHAVVS XHS Subordinate clause There are kinds of subordinate clause: noun, adjective, and adverb - An adjective...

Ngày tải lên: 13/07/2014, 23:27

... no conflict of interest exists Zaidi A, Clough P, Cooper P, Scheepers B, Fitzpatrick AP Misdiagnosis of epilepsy: many seizure-like attacks have a cardiovascular cause J Am Coll Cardiol 2000;36(1):181-4 ... 210 diagnosed as epilepsy (1, 2, 3) An ILR can be invaluable in identifying these patients and facilitating prompt therapy (3) Conflict of Interest References The authors have declared that no ... 2000;36(1):181-4 Kanjwal K, Kanjwal Y, Beverly K, Grubb BP Clinical Symptoms Associated with asystolic or bradycardic responses on implantable loop recorder monitoring in patients with recurrent...

Ngày tải lên: 26/10/2012, 08:57

Ngày tải lên: 07/11/2012, 15:06

... cultural material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained ... being a native speaker is not always an advantage, because in an intercultural approach, the teacher needs to know something about both cultures Because this approach is comparative and is based ... awareness, as a fundamental feature of language and an integral part of language learning, is important at all level.” Briefly, regardless of different points of view, the study of culture takes...

Ngày tải lên: 07/11/2012, 15:06

... cultural material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained ... being a native speaker is not always an advantage, because in an intercultural approach, the teacher needs to know something about both cultures Because this approach is comparative and is based ... awareness, as a fundamental feature of language and an integral part of language learning, is important at all level.” Briefly, regardless of different points of view, the study of culture takes...

Ngày tải lên: 07/09/2013, 13:41

... Maklumat perjawatan dan pengisian sektor awam Putrajaya: Author Retrieved March, 2007, from http://www.jpa.gov.my/imapsa/Default.aspx?alias=www.jpa.gov.my/i-mapsa/perangkaan Malek, S (2006, August ... He/she always finds fault with what the organization is doing ® He/she always pays attention to matters that are negative rather than on matters that are positive ® He/she is always complaining about ... carried out to examine the factorial validity of the Bahasa Malaysia adaptation of the job performance items Exploratory factor analysis was conducted using principal axis factoring extraction with...

Ngày tải lên: 11/09/2013, 11:44

... within a scene have the same color temperature A combination of filters and electronic adjustments is used to adapt color cameras to each new lighting situation Most cameras can adjust automatically ... or black level, of zero IRE, rather than the 7.5 IRE broadcast standard Some cameras that automatically boost the signal in low light situations can also be run in manual mode where you can control ... practice, actual contrast ranges are rarely measured using a meter A subjective analysis based on camera output is generally sufficient Color Temperature The third consideration is color temperature...

Ngày tải lên: 26/01/2014, 04:20

... English is difficult and it’s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can be a piece of ... ˈeɪʃ ən doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes Just try to speak doʊnt biː ə ˈfreɪd ʌv ˈmeɪk ɪŋ mɪ ˈsteɪk dʒʌst traɪ tuː spiːk Speak English as much as possible spiːk ˈɪŋ ...  In fact, she is a sales person! “Improve” = cải thiện, cải tiến I want to improve my English! Many people are worried about learning English ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ɪŋ...

Ngày tải lên: 27/01/2014, 20:11

... as a goal in itself rather than as a means to an end It seems that Cauldwell’s assumption is that citation forms are easy to learn or identify, although in reality that is not always the case ... taking advantages of the potential of the web? The writer ventures a guess A possible reason is that most language teachers are simply not aware of the fact that developing web-based listening materials ... greatly facilitates users’ download of the file The web abounds with free software that can be used to capture audio For example, Audacity is a good program that is highly recommended As a last...

Ngày tải lên: 24/02/2014, 18:20

... TCAGAGTTCCCTACCGAAGCAG MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT 1584p21.F: GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: ... CGCACTGTAAGACCCCAACA 6mC9.F: TCTGCACCCTCACCGTCTTC 58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: ... 423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA 500mMLCfast.R: TCTTGTAGTCCACGTTGCCG 381mMLC-2V.F: GAAGGCTGACTATGTCCGGG 403mMLC-2V.P: ATGCTGACCACACAAGCAGAGAGGTTCTC 461mMLC-2V.R: GCTGCGAACATCTGGTCGAT 958mMurf1.F...

Ngày tải lên: 07/03/2014, 03:20

... have been reported to act as phytotoxins [e.g cerato-platanin of Ceratocystis fimbriata f sp platani, Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and ... and pathogenesis-related proteins (As-CG of Coccidioides immitis, Aca1 of Antrodia camphorata and Aspf13 of Aspergillus fumigatus) It should be noted that a low similarity of H atroviridis Epl1, ... culture filtrates of Ceratocystis fimbriata f sp platani, in the cell walls of ascospores, hyphae and conidia of this fungus The authors suggested that cerato-platanin may have a similar role to...

Ngày tải lên: 07/03/2014, 12:20

... financial statements into English 63 LIST OF ABBREVIATIONS Abbreviation Full Name AFA ASC ASEAN Federation of Accountants Accounting Standards Council ASEAN Association of South East Asian nations ... general introduction of IASB and the role of IASB in making accounting harmonization process of issuance IAS Some advantages and disadvantages of various countries of application IAS in international ... companies gain the highest benefit based on this feature 2.4 DISADVANTAGES OF ACCOUNTING HARMONIZATION Analyses some of main disadvantages of accounting harmonization are necessary to evaluate and complete...

Ngày tải lên: 13/03/2014, 14:20

... suggested as one of the targets for a signal transduction pathway mediated by PknA and PknB If so, this pathway could link cell division and peptidoglycan synthesis with arabinogalactan synthesis, another ... ⁄ PAGE and the loss of labeling was visualized by autoradiography ATPase activity measurements The malachite green ATPase assay The reaction buffer contained 10 lL of 10· TMD buffer, 10 lL of ... function of EmbR as a transcriptional activator of embCAB genes in view of the fact that OmpR family members are known to interact productively with RNAP for transcriptional activation of their target...

Ngày tải lên: 16/03/2014, 14:20

... striata, Tris ⁄ HCl-injected striata and CL uninjected striata from Tris ⁄ HCl-injected rats A 60 kDa band was present in KA-injected striata (Fig 1E); this band was much weaker in CL striata, and ... death distinct from necrosis and apoptosis as defined by classical morphological and molecular criteria [17] It was also shown that excitotoxicity activates cell death programs that result in atypical ... hypotheses that BNIP3 was an important regulator of neuronal cell death induced by excitotoxic stimuli, that this form of programmed cell death occurred independently of caspase activation, and that...

Ngày tải lên: 22/03/2014, 17:20

... 2 TREND DATABASE This is a small sample aimed at illustrating the key features of our Trend Database (just one part of our 2013 Premium Service) Featuring all our trends (theory, stats, opportunities ... campaign On top of that, up to 200 new examples are added each month, and all content can be easily downloaded in various formats, then tailored and presented to your team w w w.t r en d w a ... DATABA SE SA MPLE trend watching com PREMIUM 1.1 TREND DATABASE » PREMIUM GATEWAY M SA E PL w w w.t r en d w a t chin g c om | TREND DATABA SE SA MPLE trend watching com PREMIUM 1.2 TREND DATABASE...

Ngày tải lên: 23/03/2014, 12:20

... 13 A B A A/ B b-Rha A B A A b-Rha A B A A b-Rha B A B A a-Rha B A B A a-Rha B A A a-Rha B A A A a-Rha B A A A a-Rha A A B a- Rha A A B a- Rha B A A A a-Rha B A B a- Rha Fuc3NAc B A A a-Rha Fuc3NAc ... significant NOEs for the interresidual assignment, e.g A- B for the connectivity a- Rha(1–3)b-Rha B A, B A B A A, B A A, B A A, B A A B A A A, B A A A, B A A A, B A A A, B A A A, B A A A, B A A A, B A A A ... away towards the terminal end The following fragments were assignable (the assigned a- Rha being bold): B A B A, B A B A, B A A A, B A A A, B A A A/ B, A A A, A A B, A A B, B A B, B A A, B A A, ...

Ngày tải lên: 31/03/2014, 09:20