Nghiên cứu dầu sinh học giàu axit béo omega 3 6 từ chủng vi tảo biển dị dưỡng việt nam schizochytrium mangrovei TB17 để làm thực phẩm bảo vệ sức khỏe cho con người (tt)

MINISTRY OF EDUCATION VIET NAM ACADEMY OF TRAINING SCIENCE AND TECHNOLOGY GRADUATE UNIVERSITY SCIENCE AND TECHNOLOGY - LE THI THOM RESEARCH BIO - OIL RICH IN OMEGA - FATTY ACIDS FROM VIETNAM HETEROTROPHIC MARINE MICROALGA Schizochytrium mangrovei TB17 ORIENTED FOR HUMAN HEALTH PROTECTING FOOD Major: Biochemistry Code: 42 01 16 SUMMARY OF BIOLOGY DOCTORAL THESIS Ha Noi - 2021 The doctoral thesis was completed at: Institute of biotechnology, Graduate University of Science and Technology, Vietnam Academy of Science and Technology Scientific supervisor: Prof Dr Dang Diem Hong Institute of Biotechnology, Vietnam Academy of Science and Technology Reviewer 1: … Reviewer 2: … Reviewer 3: … The doctoral thesis was be defended at the graduate university committee of doctoral this evaluation at Graduate of Science and Technology, Vietnam Academy of Science and Technology at… See the detailed thesis at: - Library of Graduate University of Science and Technology - Vietnam National Library - Institute of biotechnology LIST OF PUBLISHED WORKS (05) Le Thi Thom, Nguyen Cam Ha, Dang Diem Hong Optimization of cultural conditions for omega - fatty acids and carotenoids production by Schizochytrium mangrovei TB17 Academia Journal of Biology (accepted on 21/09/2021) Le Thi Thom, Dang Diem Hong (2021) Cultivation and extraction of omega 3-6 fatty acids from the heterotrophic marine microalga Schizochytrium mangrovei TB17 to make a functional food Research Journal of Biotechnology 16 (8): 22 - 32 (eSCIE) Le Thi Thom, Nguyen Hoang Ngan, Dang Diem Hong (2018) Safety assessement and pharmacological effect of algal oil omega - capsule rich in DHA, EPA, DPA from oil of heterotrophic marine Schizochytrium mangrovei TB17 on the experimental animals Academia Journal of Biology 40(2): 194 - 203 Le Thi Thom, Nguyen Cam Ha, Dang Diem Hong (2017) Extraction of bio - oil rich in omega - fatty acid using different methods from heterotrophic marine microalga Schizochytrium mangrovei Academia Journal of Biology 39 (3): 459 - 466 Le Thi Thom, Dang Diem Hong (2017) Study on effects of antioxidants on Bio - oil preservation rich in omega - and omega - polyunsaturated fatty acids Vietnam Journal of Biotechnology 15 (4A): 159 - 164 INTRODUCTION The urgency of the thesis Currently, for life needs as well as higher requirements in nutritional value, most people use not only common cooking oils but also high-value specialty oils (salad oil, functional oil, etc.) to serve high-class dishes, use as feedstock for the human health protection food, and pharmaceuticals industries Vegetable oils contain only unsaturated fatty acids with carbon chains ≤ 18 In which, vegetable oils such as flaxseed, canola and soybean contain polyunsaturated fatty acids in the form of omega-3 (polyunsaturated fatty acid omega -3; PUFAs ω-3) is mainly α-linolenic acid (ALA) and other oils as corn oil, cottonseed oil, grapeseed oil contain mainly PUFAs ω-6 ω-3 fatty acids with carbon numbers greater than 20 and 22 mainly derived from marine fish The main sources of docosahexaenoic acid (DHA; C22:6) and eicosapentaenoic acid (EPA; C20:5) are fleshed fish such as herring, mackerel and salmon However, the quality of natural marine fish oil depends on fish species, season and catching location; Overfishing can cause biodiversity loss and ecological imbalance Using fish-derived PUFAs in diets, including for children as well as pharmaceuticals have some disadvantages due to the contamination of polychlorinated biphenyls (PCBs) or dioxins, heavy metals as well as characteristic flavor of fish Furthermore, marine fish oil is actually a complex mixtures of fatty acids with varying carbon chain lengths and degrees of unsaturation Therefore, purifying fatty acids is very difficult and requires expensive costs before using them for different purposes as well as improving the use value of the created products compared to the original value Bio-oil rich in PUFAs - produced from some microalgae species is attracting research attention and gradually has a significant position, constantly expanding and developing strongly for the human health protection food and pharmaceuticals in the world in general and in Vietnam in particular Marine microalgae are used for many different purposes: exploiting biologically active substances, environmental treatment, fertilizer, biofuel and using widely in aquaculture with some traditional photoautotrophic marine microalgae species However, the high cost of cultivation photoautotrophic marine microalgae cause the high production cost of products from algal biomass, lead to a limitation the commercialization on large scale In order to overcome the above-mentioned disadvantages, the search, exploitation and application of heterotrophic marine microalgae including the genus Schizochytrium are attracting much research attention of domestic and abroad scientists but it is still very new in Vietnam and promises to bring many practical benefits to people's lives Heterotrophic marine microalga Schizochytrium mangrovei has the ability to accumulate high lipid content, which can be up to 70% of dry cell weigh (DCW) and -3 PUFAs content such as EPA, DHA accounting for 30-50% of total fatty acids (TFA) The role of above mentioned -3 PUFAs has been shown to be beneficial for the infant brain development, cardiovascular, nervous system and supporting in many therapies for cancer treatment, dementia, and depression Currently, the heterotrophic marine microalga S mangrovei is considered as one of the potential candidates to replace the traditional source of -3 PUFAs production from fish oil In Vietnam, the studies on biomass production, extraction and application of fatty acids from heterotrophic marine microalga are still scarce but appeared to have great potential for application Therefore, we wish to be carried out the project “Research bio-oil rich in omega - fatty acids from Vietnam heterotrophic marine microalga Schizochytrium mangrovei TB17 oriented for human health protecting food” Research objectives of the thesis - Screening and determining suitable culture conditions for strain/species of heterotrophic marine microalga to product biomass rich in ω - fatty acids; - Optimizing the conditions for extraction, purification and storage to obtain bio - oil rich in ω - fatty acids from selected marine microalgae; - Production bio-oil capsules rich in ω - fatty acids with high safety and evaluate the effect of improving memory, learning ability of capsules on experimental animals The main research contents of the thesis - Screening potential strain rich in ω - fatty acids from some marine heterotrophic microalgal species of Vietnam; optimizing the culture conditions to obtain algae biomass from selected potential strain at flask and bioreactor 5, 10, 30 and 150 Liter scales - Optimizing the conditions for extraction, purification and storage of biooil rich in ω - fatty acids in order to provide quality material for application as food to protect human health; - Production of Algal Oil Omega 3-6 (AOO-3-6) capsules from bio - oil rich in ω - fatty acids with quality assurance, high safety and evaluation of the effect of improving memory, learning ability of capsules on experimental animals Chapter Literature review Fatty acids with the general formula: CH3-(CH2)n-COOH PUFAs are long chain fatty acids (18 - 22 carbons) containing two or more double bonds The hydrocarbon chain has two ends with a methyl group at one end and a carboxyl group at the other end They are classified according to the position of the first double bond from the methyl or carboxyl group Letter "n" or "ω" can be used to indicate the position of the first double bond on carbon chain counting from terminal methyl group The double bonds in PUFAs can also be counted from the carboxyl group and are denoted “Δ” The ω-3, ω-6 or ω-9 PUFAs groups have the first double bond at the 3, or carbon positions, respectively, counting from the methyl group (Singh et al., 2014) There are two important groups of non-substituted fatty acids include ω - and ω - The most important ω - fatty acids are ALA (C18:3), EPA, DHA, DPA (C22:5 ω-3) The main ω-6 fatty acids are Linoleic acid (LA; C18:2 ω-6), gamma linoleic (GLA - C18:3), eicosadienoic, dihomo-gammalinolenic (DGLA), ARA (C20:4), DPA (C22:5 ω-6) (Mu et al., 2016) Fatty acids ω - play an key role involved in lipid metabolism, transport and delivery to tissues This make an important contribution in regulation of the membrane protein activity They are important component that make up brain cells, vision, nervous system and contribute to effective improvement of cardiovascular disease, reducing the risk of arrhythmias; markedly effective treatment of asthenia; reducing the risk of prostate cancer development; slowsgrowing of atherosclerotic plaques (Nagy, 2017); as important feed ingredient because it is necessary for enhancing the survival rate, development and metamorphosis of larvae (Becker, 2004)… Heterotrophic marine microalgae are able to accumulate high amounts of ω-3 PUFAs with following advantages: Heterotrophic marine microalga cultivation is easy in fermentation systems led to oil producing input all year round, regardless of season and temperature, by its ability to control all necessary parameters during biomass culture, simple fatty acid composition and higher growth rate as compared with photoautotrophic marine microalga cultivation in open tank and closed systems (Bumbak et al., 2011) Many studies has shown that optimization of thraustochytrids culture conditions can significantly improve biomass yield and DHA content (Chen et al., 2016; Jiang et al., 2017) Biomass can reach 171.5 g/L (Bailey et al., 2003), TFA content can account for 83.84% of dry cell weigh (DCW) (Li et al., 2015), PUFAs content reached with high value of 76.5% (Marchan et al., 2017) Microalgae oil production is considered as a sustainable alternative solution that contributes to meeting the growing demand in using bio-oil rich in ω-3-6 fatty acids (Finco et al., 2017) Together with the genus Labyrinthula, Schizochytrium is a heterotrophic marine microalgae genus belonging to the Thraustochytrids family, first published in Vietnam since 2008 (Dang Diem Hong et al., 2008) These genera have been discovered and isolated in some mangrove areas of Vietnam such as Hai Phong, Nam Dinh, Thanh Hoa, Thai Binh, Binh Dinh and Phu Quoc island district belonging to Kien Giang province These genera have high DHA content up to 5-7% of DCW (5-10 times higher than that of all known microorganisms and marine microalga today in Vietnam), DCW of 30 g/L (Hoang Thi Lan Anh et al., 2010) However, during the biomass cultivation of PQ6 strain, it was shown that the strain only contains mainly DHA and EPA fatty acids, accounting for 43.58 and 0.75% compared to TFA, respectively The DPA ɷ-3 content is very low or even absent in cultivation of this strain at flasks and 5, 10 and 150 liters fermentation systems (Dang et al., 2011; Hien et al., 2013) For example, when cultured biomass in the bioreactor systems of and 10 liters, only DHA appeared at level of 8.71 and 11.55 g/L, respectively The fatty acid composition of strain PQ6 when cultured biomass in a 150 liter bioreactor contain only DHA and EPA (without DPA -3) accounted for 32.98 and 0.67% compared to TFA Therefore, it is necessary to find strains containing not only DHA, EPA but also DPA -3 - an important and essential fatty acid for human health with biological effects even higher than DHA and EPA - fatty acid with high and stable content in producing at all different culture levels From the obtained biomass, extracting and purifying the mixture of fatty acids to ensure safety and biopharmaceutical effects for application as food to protect human health are an essential research currently in Vietnam Chapter Materials and methods 2.1 Materials 2.1.1 Algae strains and culture conditions - 22 strains Schizochytrium spp isolated from mangrove areas of Vietnam in 2008 - 2015, belonging to heterotrophic marine microalga collection culture of the Algae Technology Department, Institute of Biotechnology were used for the study 2.1.2 Experimental animal - White rats, white mice are provided by the Laboratory Animal Department - Vietnam Military Medical University 2.1.3 Algae biomass and speific primer pairs - Fresh biomass Schizochytrium sp TB17 was stored at -20ºC until used Specific primer pair 18S001: AACCTGGTTGATCCTGCCAGTA (22 nu) 18S13: CCTTGTTACGACTTCACCTTCCTCT (25 nu) was used to amplify 18S rRNA gene of heterotrophic marine microalgae species of genera Schizochytrium, Thraustochytrium with expected gene sizer of 1.7 bp according to report published by Honda et al., (1999) 2.2 Chemicals and equipments - The used chemicals and equipments in the research include common chemicals manufactured by Vietnam, China, the US, etc., and common and necessary equipments and machines in the laboratory 2.3 Culture medium - Medium GPY (g/L): glucose (2), yeast extract (0.5), polypeptone (1), artificial seawater (17.5), agar (15) was used to maintain strains - M1 basic medium (g/L): glucose (30), yeast extract (10), artificial seawater (17.5) was used in screening strains and selection culture conditions for strains of Schizochytrium spp - Culture medium of Schizochytrium spp in bioreactor systems of 5, 10, 30 and 150L using M12 medium including (g/L): glucose (90), industrial yeast extract (10), artificial seawater (17.5) - The fed-batch culture medium is the P1 medium as report of Pora et al (2014) with the composition (g/L): glucose (75), urea (10), yeast extract (12), NaCl (2.5), KH2PO4 (9.6), MgSO4 (12), CaCl2 (1.2), NaHCO3 (1.2), Na2SO4 (0.8), micronutrients (56 mL/L), 150 mL vegetable oil In which, stock of micronutrients has the composition (g/L) as MnCl2.2 H2O (8.6), CoCl2.6H2O (0,2), NiSO4 6H2O (7.5), Na2MoO4 6H2O (0.15), ZnSO4.7H2O (5.7), CuSO4 5H2O (6.5), FeSO4 7H2O (32), ZnCl2 (1.5) 2.4 Research methods 2.4.1 Screening and biomass cultivation of potential strains in different culture systems for high accumulation of fatty acids - - Determination growth through two parameters of cell density counted by Burker - Turk counting chamber (Germany) and dried algal biomass (dried to constant weight at 105C) - Determination of residual glucose in fermentation medium according to Miller's method (1959) - Lipid staining using Nile red (Jara et al., 2003) - Take pictures of cell morphology under fluorescence microscope and transmission electron microscope (TEM) - Analysis of composition and content of fatty acids in algae biomass (Dang Diem Hong et al., 2007) 2.4.2 Method for extraction and enrichment of fatty acids rich in ω3 - - The total lipid content was determined by the method of Bligh and Dyer (1959) - Total lipid content was determined by soxhlet method (Nguyen Van Mui, 2001) - Extraction of free fatty acids (FFAs) from crude oil (lipids) (Johnson and Wen, 2009) - Enrichment of mixture of bio-oil rich in fatty acids ω - from FFA mixture by urea complexation (Johnson and Wen, 2009) - Extraction of TFA and enrichment of mixture of bio-oil rich in fatty acids ω - in form of methyl esters (Johnson and Wen, 2009) - Enrichment of fatty acids ω3 - in form of methyl esters by urea complexation (Johnson and Wen, 2009) - Purification conditions of bio-oil rich in fatty acids ω3 - in form of methyl esters (Johnson and Wen, 2009) 2.4.3 Determination of oil quality parameters - Determination the acid index of mixture of bio-oil rich in fatty acids ω - (according to TCVN (Vietnamese standards) 6127: 2007 and Nguyen Van Mui (2001) - Determination peroxide index of mixture of bio-oil rich in fatty acids ω3 - (according to TCVN 6121:2007) - Determination iodine index of mixture of bio-oil rich in fatty acids ω3 - (Pham Thi Tran Chau et al., 1998) - Quantitative determination of urea in the oil mixture ω 3-6 (according to TCVN 184: 2003) - Determination of sensory state according to TCVN 2627-1993 - Determination of heavy metals contens and microorganisms according to the method AOAC 999.10, Mercury (Hg): AOAC 971.21, Arsenic (As): AOAC 986.15, Total aerobic bacteria: ISO 4833 - 1: 2013, E coli: ISO 7251:2005, Coliforms: ISO 4831:2006, Staphylococcus aureus: ISO 6888 - 1: 1999, Sreptococccus faecal: ISO 6889 - 1: 1999, Salmonella: ISO 6579: 2002, P aerugimosa: ISO 6580: 2002 Total number of yeasts and moulds: ISO215271:2008 2.4.4 Safety assessement and effects of improving memory, learning ability of AOO-3-6 capsules - Acute toxicity and semi-chronic toxicity of AOO-3-6 capsules and LD50 value were determined by method of Litchfield-Wincoxon (Dam Trung Don, 2001; 2014), by regulations of the Vietnam Ministry of Health (2018), by guidelines of Organization for Economic Cooperation and Development (OECD) (2000) and World Health Organization (2000) - The effect of improving memory, learning ability of AOO-3-6 capsules according to Nguyen Liem et al (2002) 2.5 Design experimental 2.6 Statistical analysis of the data Data are presented as mean ± standard error The difference is considered to be statistically significant at p