Analysis of variation in the sla drb1 allelic type and frequency among seven different pig breeds using a comprehensive high resolution genotyping

Supervisor: Prof Chankyu Park Analysis of variation in the SLA-DRB1 allelic type and frequency among seven different pig breeds using a comprehensive high resolution genotyping Submitted by Le Minh Thong 2010.02 Master’s Program in Department of Animal Biotechnology Graduate school of Konkuk University Seoul, Korea i 석사학위 청구논문 지도교수 박 찬규 Analysis of variation in the SLA-DRB1 allelic type and frequency among seven different pig breeds using a comprehensive high resolution genotyping 고해상도 SLA-DRB1 유전자형 분석 기술의 개발 및 품종 간 특성분석 2010 년 월 건국대학교 대학원 동물생명공학과 레민통 ii Supervisor: Prof Chankyu Park Analysis of variation in the SLA-DRB1 allelic type and frequency among seven different pig breeds using a comprehensive high resolution genotyping Submitted by Le Minh Thong 2010.02 A thesis submitted for the degree of Master of Science Department of Animal Biotechnology Graduate school of Konkuk University Approved by Examination Committee: Chairman: Member: Member: iii TABLE OF CONTENTS LIST OF FIGURES LIST OF TABLES Abstract Introduction 2 Materials and Methods 2.1 Animal 2.2 Isolation of genomic DNA and RNA 2.3 Primer designing and PCR amplification 2.4 Cloning and plasmid isolation 2.5 DNA sequencing .6 2.6 Alleles discrimination and population analysis Results and discussion .7 3.1 Generation of intronic sequences to design a primer set for SLA-DRB1 exon2 genotyping 3.2 Designing of PCR primers for SLA-DRB1 specific amplification 11 3.3 Designing of a DRB1 genotyping protocol using direct sequencing .13 3.4 Evaluation of the accuracy of genotyping results 14 3.5 Allelic diversity of SLA-DRB1 .16 References 22 초록 28 Appendix 29 iv LIST OF FIGURES Figure 1: The amplification position of primers on exon 10 Figure 2: The PCR products amplified from exon of DRB1 region 12 Figure 3: Effect of the specific primer of method .13 Figure 4: The structure of MHC class II and map of primers used in the method 14 Figure 5: The phylogenetic analysis of assigned alleles and new alleles C21-12 18 v LIST OF TABLES Table PCR primers used for the amplification of SLA-DRB1 regions and sequence analysis Table Comparison of allele types and frequencies of SLA-DRB1 alleles among seven pig breeds by genomic sequence based typing .17 Table Differences in SLA-DRB1 heterozygosity among seven pig breeds 19 Table Summary of DQB1-DRB1 haplotypes detected in this study from KNP, SNU minature and NIH miniature pigs 20 vi Abstract As an effort to enable simple and comprehensive high resolution genotyping of swine leukocyte antigens (SLA) genes, a SLA-DRB1 genomic sequence based typing (GSBT) method was developed for genotype a hyperpolymorphic MHC class II beta chain gene, DRB1 To obtain sequence information of intronic regions surrounding SLA-DRB1 exon from diverse alleles, DNA fragments of introns and from 10 functional SLA-DRB1 alleles and pseudogenes were cloned, and analyzed in sequence variations The results showed that the presence of extreme nucleotide variations including substitutions and deletions The information allowed design a unique strategy for comprehensive genotyping of SLA-DRB1 according to the criteria defined by Society for Animal Genetics Nomenclature Committee for Factors of the Swine Leukocyte Antigen System In this study, the efficiency, accuracy, and robustness of the method were demonstrated by comparing the results with various previous methods including cDNA SBT, PCR-SSP typing, allele segregation analysis, and heterozygous simulation typing Genotyping of 336 animals was performed with 15 DRB1 alleles identified including one new allele Ten DQB1-DRB1 haplotypes including new haplotypes also were defined Population analysis using different breeds showed difference in DRB1 allele frequency among pig breeds This is the first report on the development of high resolution comprehensive genotyping method of SLA-DRB1 developed by a systemic analysis of intronic polymorphisms for diverse SLA-DRB1 alleles 1 Introduction The major histocompatibility complex (MHC) of pigs, also called as swine leukocyte antigens (SLA), is encoded by one of the most polymorphic region of pig genome which consist of a group of genes designated as SLA class I and class II system (Kelley et al, 2005; Rothschild et al, 1998) SLA proteins function mainly in presenting self and non-self peptides on the surface of cells to T lymphocytes, and therefore they play a vital role in the development and control of the swine immune system (Lechler et al, 1994, Federica et al, 2009; Maiko et al, 2009) Numerous studies demonstrated the repeated association of SLA complex to immune responsiveness, disease resistance and susceptibility, as well as reproductive performance and production chacracteristics (Renard et al, 1989, Kristensen et al, 1995; Gautschi et al, 1990) Morever, not only have pigs served as an important nutritional source but also a valuable asset to the field of biomedical science (Vodicka et al, 2005) and possible organ or tissue donors for xenotransplantation (Dehoux et al, 2007; Lunney et al, 2007) In order to study the influence of SLA polymorphisms on animal health and other traits, a robust typing method is needed to precisely characterize the alleles of major SLA genes SLA typing has been attempted using a several methods including serology (Ivanoska et al, 1991), mix lymphocyte culture (Rothschild et al, 1984), restriction fragment length polymorphism (RFLP) analysis (Chardon et al, 1985), PCR-RFLP (Ando et al, 2003; Lee et al 2005), analysis of SLA linked microsatellite (Tanaka et al, 2005; Nunez et al, 2004), sequence-specific oligonucleotide typing (Olerup et al, 1993), and sequencing of genomic DNA, cDNA, or cloned PCR products (Middleton et al, 1999; Ho et al, 2005, Erin et al, 2009) The International Society for Animal Genetics Nomenclature Committee for Factors of the Swine Leukocyte Antigen System recently established the principles of a systematic nomenclature system for SLA class I and class II genes and alleles by means of DNA sequencing (Ho et al, 2009), which requires the development of robust and accurate sequence-based typing (SBT) methods for characterization of SLA polymorphisms However, the existing methods including cDNA SBT methods still have several disadvantages such as needs for RNA isolation and DNA cloning which are not suitable for large scale studies and relatively labor extensive, difficulty in excluding the pseudogenes from related functional genes (Vage et al, 1994; Gustafsson et al, 1990), and unequal amplification of specific alleles in heterozygotes due to the hypervariability of SLA genes This study described the development of a comprehensive and simple genomic sequence based typing (GSBT) method which allows the identification of SLA-DRB1 alleles directly using combination of genomic DNA PCR and direct sequencing In this study, as a trial for developing a high efficiency genotyping system for SLA, 336 pigs from seven breeds were successfully genotyped using SLA-DRB1 GSBT showed the efficiency, accuracy as well as robustness of the method This method can be widely used to overcome obstacles existing in field of SLA genotyping and contribute to establish the complete list of SLA polymorphism Materials and Methods 2.1 Animals Experiments were conducted using 336 pigs, consisted of breeds, 114 SNU miniature pigs derived from Chicago medical university, 105 Korean native pigs (KNP), 73 NIH miniature pigs, 11 Berkshire, 12 Duroc, 10 Landrace, and 11 Yorkshire KNP, SNU and NIH breeds had pedigree information This study also used 22 additional pigs consisted of 14 SNU, KNP and Yorkshire for the comparison of cDNA and genomic DNA typing results 2.2 Isolation of genomic DNA and RNA Genomic DNA was isolated from blood or tissue samples as described by Miller et al (1988) The isolation of total RNA was performed using the RNeasyTM Mini Kit according to manufacturer’s instructions (Qiagen, Germany) 2.3 Primer design and PCR amplification DNA sequence alignments were performed using ClustalW (http://www.ebi.ac.uk/Tools/clustalw2) PCR primers were designed using Primer (http://frodo.wi.mit.edu/primer3) For genomic PCR, amplification reactions were performed in a 20 μl reaction containing 50 ng genomic DNA, 0.5 μM of each primer, 200 μM dNTPs, PCR buffer [10 mM Tris (pH 8.3), 50 mM KCL, 1.5 mM MgCl], and 0.5 U of SuperthermTM DNA polymerase (JMR Holdings, Kent, UK) using Thermocycler 3000 (Biometra, Germany) Cycling profiles for PCR were an suggested that different pig breeds may have different MHC allele profiles and therefore have different characteristics in immune response With the genotyping results of SLA-DQB1 performed in our other study (Park et al., submitted), the DQB1-DRB1 haplotypes were analyzed from the results Only the haplotypes for SNU miniature, KNP and NIH miniature pigs able to be analyzed since pedigree information was not available for other breeds Ten different haplotypes, from SNU miniature, from KNP and from NIH miniature pigs were detected (Table 4) Haplotype DQB1*0201/DRB1*0201 was present in both SNU and NIH breeds Comparing the haplotypes of SLA class II with those reported in the IPD, four new haplotypes, 0301/Wu01, 0701/0404, 040101/C21-12, 0601/1001, were identified in this study Table Summary of DQB1-DRB1 haplotypes detected in this study from KNP, SNU minature and NIH miniature pigs Haplotypes Breed DQB1 SNU KNP NIH DRB1 Association with known haplotypes1 0201 0201 Hp-0.2 0301 0301 Hp-0.3 0301 Wu01 New Hp1 0701 0404 New Hp2 0101 0101 Hp-0.1 0303 0403 Hp-0.13 040101 c21-122 New Hp3 0503 1101 Hp-0.30 0601 1001 New Hp4 0201 0201 Hp-0.2 0201 Hp-0.4 040101 IPD-MHC SLA Sequence Database A new allele identified in this study 20 New SLA-DRB1 genotyping method, GBST, provides several advantages comparing to the previously reported methods such as no requirement of prior sequence information for new alleles, no need of a DNA cloning step, use of genomic DNA for PCR templates, eliminate pseudogene noise, capable of detecting new alleles and comprehensive genotyping of all DRB1 alleles Since new SLADRB1 typing method was successfully applied to distinguish 15 alleles which showed diverse phylogenetic relationships, it is potential to expect that new method could be applicable to other untested alleles It will be interesting to apply the method to exploit new SLA-DRB1 alleles for animals from diverse pig breeds 21 References Ando A, Ota M, Sada M, Katsuyama Y, Goto R, Shigenari A, Kawata H, Anzai T, Iwanaga T, Miyoshi Y and others (2005) Rapid assignment of the swine major histocompatibility complex (SLA) class I and II genotypes in Clawn miniature swine using PCR-SSP and PCR-RFLP methods Xenotransplantation 12:121-126 Brunsberg U, Edfors-Lilja I, Andersson L, Gustafsson K (1996) Structure and organization of pig MHC class II DRB genes: evidence for genetic exchange between loci Immunogenetics 44:1-8 Chardon P, Vaiman M, Kirszenbaum M, Geffrotin C, Renard C, Cohen D (1985) Restriction fragment length polymorphism of the major histocompatibility complex of the pig Immunogenetics 21:161-171 Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG and Thompson JD (2003) Multiple sequence alignment with the Clustal series of programs Nucleic Acids Res 31: 3497-3500 Dehoux JP and Gianello P (2007) The importance of large animal models in transplantation Front Biosci 12: 4864-4880 Erin S Luetkemeier, Ripan S Malhi, Jonathan E Beever, Lawrence B Schook (2009) Diversification of porcine MHC class II genes: evidence for selective advantage Immunogenetics 61:119–129 22 Federica Barbisan & Claudia Savio & Giorgio Bertorelle & Tomaso Patarnello & Leonardo Congiu (2009) Duplication polymorphism at MHC class II DRB1 locus in the wild boar (Sus scrofa) Immunogenetics 61:145-151 Gautschi C, Gaillard C (1990) Influence of major histocompatibility complex on reproduction and production traits in swine Anim Genet 21:161-170 Gustafsson K, Germana S, Hirsch F, Pratt K, LeGuern C, Sachs DH (1990) Structure of miniature swine class II DRB genes: conservation of hypervariable amino acid residues between distantly related mammalian species Proc Natl Acad Sci USA 87:798-802 Ho C-S, Rochelle ES, Martens GW, Schook LB and Smith DM (2006) Characterization of swin leukocyte antigen polymorphism by sequence-based and PCR-SSP methods I Meishan pigs Immunogenetics 58:873-882 Hwang In-Taek, Kim Yun-Jee, Kim Seung-Hyun, Kwak Chae-Il, Gu Young-Yun, and Chun Jong-Yoon (2003) Annealing control primer system for improving specificity of PCR amplification BioTechniques 35:1180-1184 Ibrahim A, Hofman-Bang J and Ahring BK (2001) Amplification and direct sequence analysis of the 23S rRNA gene from thermophilic bacteria Biotechniques 30:414-416 IPD-MHC SLA Sequence http://www.ebi.ac.uk/ipd/mhc/sla/index.html 23 Database Ivanoska D, Sun DC, Lunney JK (1991) Production of monoclonal antibodies reactive with polymorphic and monomorphic determinants of SLA class I gene products Immunogenetics 33:220-223 Kelley J, Walter L and Trowsdale J (2005) Comparative genomics of major histocompatibility complexes Immunogenetics 56:683-695 Kristensen B (1995) Possible influence of parental MHC class I on survival of offspring from sows naturally infected with porcine reproductive and respiratory syndrome virus (PRRSV) Int Symp PRRS 2:44 Lechler R (1994) Mechanisms of HLA and disease associations In HLA in Health and Disease R Lechler eds, Academic Press Inc San Diego, CA, pp 83-91 Lee J-H, Simond D, Hawthorne WJ, Walters SN, Patel AT, Smith DM, O’Connell PJ and Moran C (2005) Characterization of the swine major histocompatibility complex alleles at eight loci in Westran pigs Xenotransplantation 12:303-307 Lunney JK (2007) Advances in swine biomedical model genomics Int J Biol Sci.103:179-184 Maiko Tanaka-Matsuda, Asako Ando, Claire Rogel-Gaillard, Patrick Chardon and Hirohide Uenishi (2009) Difference in number of loci of swine leukocyte antigen classical class I genes among haplotypes Genomics 93:261–273 24 Martens GW, Lunney JK, Baker JE, Smith DM (2003) Rapid assignment of swine leukocyte antigen haplotypes in pedigreed herds using a polymerase chain reaction-based assay Immunogenetics 55:395-401 Miller SA, Dykes DD and Polesky HF (1988) A Simple salting out procedure for extracting DNA from human nucleated cells Nucleic Acids Res 16:12-15 Olerup O, Aldener A, Fogdell A (1993) HLA-DQB1 and -DQA1 typing by PCR amplification with sequence-specific primers (PCR-SSP) in hours Tissue Antigens 41:119-134 Renard C, Hart E, Sehra H, Beasley H, Coggill P, Howe K, Harrow J, Gilbert J, Sims S, Rogers J and others (2006) The genomic sequence and analysis of the swine major histocompatibility complex Genomics 88:96-110 Renard C, Vaiman M (1989) Possible relationships between SLA and porcine reproduction Reprod Nutr Dev 29:569-576 Rothschild MF, Chen HL, Christian LL, Lie WR, Venier L, Cooper M, Briggs C, Warner CM (1984) Breed and swine lymphocyte antigen haplotype differences in agglutination titers following vaccination with B bronchiseptica J Anim Sci 59:643-649 Rothschild MF, Ruvinsky A (1998) Genetics of the Pig 622 Oxon, UK.: CABI Press; 640 p 25 Rothschild MF, Zimmerman DR, Johnson RK, Venier L, Warner CM (1984) SLA haplotype differences in lines of pigs which differ in ovulation rate Anim Blood Groups Biochem Genet 15:155-158 Shia YC, Bradshaw M, Rutherford MS, Lewin HA, Schook LB (1995) Polymerase chain reaction based genotyping for characterization of SLA-DQB and SLA-DRB alleles in domestic pigs Anim Genet 26:91-100 Shishido S, Naziruddin B, Howard T, Mohanakumar T (1997) Recognition of porcine major histocompatibility complex class I antigens by human CD8+ cytolytic T cell clones Transplantation 64:340-346 Smith DM, Lunney JK, Ho CS, Martens GW, Ando A, Lee JH, Schook L, Renard C, Chardon P (2005) Nomenclature for factors of the swine leukocyte antigen class II system, 2005 Tissue Antigens 66:623-639 Tanaka M, Ando A, Renard C, Chardon P, Domukai M, Okumura N, Awata T and Uenishi H (2005) Development of dense microsatellite markers in the entire SLA region and evaluation of their polymorphisms in porcine breeds Immunogenetics 57:690-696 Vage DI, Olsaker I, Lingaas F, Lie O (1994) Isolation and sequence determination of porcine class II DRB alleles amplified by PCR Anim Genet 25:7375 26 Vodicka P, Smetana K, Jr., Dvorankova B, Emerick T, Xu YZ, Ourednik J, Ourednik V, Motlik J (2005) The miniature pig as an animal model in biomedical research Ann N Y Acad Sci 1049:161-171 Yeh Francis C and Rong-cai Yang, 1999 POPGENE VERSION 1.31, Microsoft Window-based Freeware for, Population Genetic Analysis 27 초록 돼지 주조직 적합성 복합체 유전자의 단순하고 광범위한 고해상도 유전자형 분석을 가능케 하기 위한 노력으로 우리는 고도의 다형성을 가짂 주조직 적합성 복합체의 베타 체인 유전자인 SLA-DRB1 를 유전자형 분석할 수 있는 SLA-DRB1 genomic sequence based typing (GSBT) 방법을 개발하였다 다양한 SLA-DRB1 대립유전자들로부터 SLA-DRB1 의 엑손 주변 인트롞의 염기서열정보를 얻기 위해 10 개의 기능적인 대립유전자와 개의 위유전자로부터 인트롞 과 인트롞 부분이 클로닝되었고, 그 서열들의 변이들이 분석되었다 그 결과, 서열의 치환과 결실을 포함하는 극도의 염기서열 변이들의 존재를 확인하였다 이 정보들은 돼지 백혈구 항원 유전자 시스템의 요소를 위한 Animal genetics Nomenclature committee society 의 분류 정의에 따르면, SLA-DRB1 유전자의 광범위한 유전자형분석 방법 개발을 위한 단 하나의 전략이라고 할 수 있다 우리는 cDNA SBT, PCR-SSP, 대립유전자 분리분석, 이형접합자의 모의시험 분석 등을 포함하는 기존의 다양한 방법들의 결과와 비교함으로써, GSBT 방법의 효과, 정확성, 확고성을 설명했다 또한, 336 두의 돼지에 대하여 SLA-DRB1 유전자형분석을 하였고, 한 개의 새로운 대립유전자를 포함하는 총 15 개의 SLA-DRB1 대립유전자를 확인하였다 그리고, 개의 새로운 haplotype 을 포함하는 총 10 개의 SLA class II haplotype 을 정의했다 서로 다른 개의 품종을 이용한 개체군 분석은 각 돼지 품종별로 SLA-DRB1 대립유전자의 빈도가 서로 다름을 확인할 수 있었다 이 연구는 전세계 최초로 다양한 SLA-DRB1 대립유전자의 인트롞 서열의 다형성을 체계적으로 분석하여, 고해상도, 광범위한 SLA-DRB1 유전자형 분석방법을 개발한 것이라 할 수 있다 개발된 SLA-DRB1 GSBT 방법은 돼지산업에서의 육종과, 이종장기이식분야에서 무균돼지 육종 및 생산에 활용될 수 있을 것이다 28 Appendix Supplementary Table The result of allele segregation analysis from parents to offsprings Breed1 No of No of Individuals No alleles3 Family (Parents/offsprings)2 No of KNP 53 (11 / 42) NIH 23 66 (25 / 51) SNU 15 78 (21 / 64) exception4 Total 45 197 (57 / 157) 95 KNP, Korean native pigs;NIH, NIH miniature pigs; SNU, SNU miniature pigs which were derived from Chicago medical university miniature pigs Parent animals are shared among a few families The number of segregating alleles within families The number of cases showing exceptions in allele segregation between parents and offsprings The number of unique alleles 29 Supplementary Table Comparison of results between newly developed gDNA and previous RT-PCR based genotypings Breed SNU KNP Yorkshire Sample cDNA gDNA K8002-1 0301 0301 K8002-2 0301 0301 K8002-3 0301 0301 K8002-4 0301 0301 K8005-1 0301 0301 K8005-2 0201/0301 0201/0301 K8005-4 0301 0301 KUN-1 0301 0301 KUN-2 0301 0301 KUN-3 0301 0301 KUN-4 0201/0301 0201/0301 KUN-5 0201/0301 0201/0301 KU 3-42 0201/0301 0201/0301 KU 3-47 0301 0301 KNP1-1 1001/1101 1001/1101 KNP1-2 0101/1001 0101/1001 KNP1-3 0101/1001 0101/1001 KNP2-1 0403/1101 0403/1101 KNP-P5 1001/1101 1001/1101 KNP-P5F 0101/1001 0101/1001 KNP-P9 1101/new 1101/new KNP-P24 1101/new 1101/new Y4-1 0201 0201 Y4-2 0701 0701 30 Supplementary Table Results of heterozygote simulation genotypings by artificially mixing an equal amount of DNA from two different alleles GSBT1 Result Alleles pooled 0101 , 0201 0101/0201 0201 , 0301 0201/0301 0301 , 0901 0301/0901 0901 , 1001 0901/1001 1001 , Wu01 1001/Wu01 Wu01 , 04ns01 Wu01/04ns01 04ns01 , 1101 04ns01/1101 1101 , 1001 1101/1001 Genomic sequence based typing developed in this study 31 Supplementary Table The Combined results of SLA-DRB1 sequence based typing from seven pig breeds (n= 336) Genotype Number of animals 0101 0101/0201 0201 86 0201/0301 23 0301 24 0101/0403 0201/04ns01 10 0301/04ns01 15 04ns01 0101/0701 0201/0701 0101/0901 0201/0901 0501/0901 0901 0101/1001 18 0201/1001 0403/1001 0901/1001 1001 17 0101/1101 15 0403/1101 1001/1101 18 1101 0603Q/1301 0901/1301 0201/bs113 0701/bs113 0901/bs113 0201/wu01 14 0301/wu01 04ns01/wu01 32 0901/wu01 wu01 10 0101/new 0403/new 1001/new 1101/new 33 Supplementary table The Summary of SLA-DRB1 genotyping results from 336 animals consisted of seven breeds Breed DRB1 genotype No of individual KNP (105) 0101 0101/0403 0101/0901 0101/1001 0101/1101 0101/c21-12 0403/1001 0403/1101 0403/c21-12 1001 1001/1101 1001/c21-12 1101 1101/c21-12 17 15 14 18 NIH minipig (73) 0201 73 SNU (114) 0201 0201/0301 0201/0404 0201/Wu01 0301 0301/0404 0301/Wu01 0404 0404/Wu01 Wu01 23 14 24 15 10 34 DRB1 genotype No of individual Duroc (12) 0201 0501/0901 0901 0901/0402 1 Landrace (10) 0201/0901 0201/1001 0901/1001 1001 Yorkshire (11) 0101 0101/0201 0101/0701 0101/0901 0101/1001 0201/0701 0201/0402 0701/0402 0901/Wu01 1 1 2 1 Berkshire (11) 0101 0101/0201 0201 0201/0404 0201/0901 0603Q/1301 0901 0901/1301 1 2 Total 336 ... Supervisor: Prof Chankyu Park Analysis of variation in the SLA- DRB1 allelic type and frequency among seven different pig breeds using a comprehensive high resolution genotyping Submitted by Le Minh Thong...석사학위 청구논문 지도교수 박 찬규 Analysis of variation in the SLA- DRB1 allelic type and frequency among seven different pig breeds using a comprehensive high resolution genotyping 고해상도 SLA- DRB1 유전자형 분석 기술의 개발... CGGTGCCTTCAGCCTTTTCAGGAG T7 GTAATACGACTCACTATAGGGC SP6 ATTTAGGTGACACTATAG DRB1 partial exon cDNA1 DRB1 full length cDNA Sequencing Ando et al, 2005 The 610~618 bp of the sequences consisted of 295 bp of intron